|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
188631_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.6567
|
|
Exemplar sequence
|
|
F23F12.6 NCBI
|
|
F23F12.6 /REP_DB=WormBase Gene ID /WP=CE01253 /GEN=rpt-3 /TR=SW:P46502 /GB=AAA20608.1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_066028(11) |
|
|
|
|
|
NM_066028 NCBI |
Caenorhabditis elegans proteasome Regulatory Particle, ATPase-like family member (rpt-3) (rpt-3) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000039914 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:6488569:6491113:1 |
11/11 |
None |
SNAP00000039902 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:6489734:6491113:1 |
11/11 |
None |
F23F12.6.2 ENSEMBL |
cdna:known chromosome:CEL140:III:6489728:6491217:1 gene:F23F12.6 |
11/11 |
None |
F23F12.6.1 ENSEMBL |
cdna:known chromosome:CEL140:III:6489730:6491217:1 gene:F23F12.6 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:6489732-6491112(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
rpt-3
|
|
F23F12.6
|
|
175925 Entrez gene
|
|
P46502 EMBL-EBI
|
|
CE01253 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:247810_AT |
26S proteasome AAA-ATPase subunit (RPT3) |
at |
CANINE:1592147_S_AT |
similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7) |
cfa |
CANINE:1591441_S_AT |
similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7) |
cfa |
CANINE_2:CFA.14694.1.A1_AT |
similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7) |
cfa |
CANINE_2:CFA.14694.1.A1_S_AT |
similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7) |
cfa |
CANINE_2:CFA.17798.1.S1_S_AT |
similar to 26S protease regulatory subunit 6B (MIP224) (MB67 interacting protein) (TAT-binding protein-7) (TBP-7) |
cfa |
DROSOPHILA_2:1637341_AT |
|
dm |
DROSGENOME1:144245_AT |
|
dm |
HG-U133_PLUS_2:201252_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
HG-U133A:201252_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
HG-FOCUS:201252_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
HG-U133A_2:201252_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
HU35KSUBA:RC_AA441978_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
HU35KSUBA:D82226_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
U133_X3P:G5729990_3P_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
HG-U95AV2:32848_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
HG-U95D:68405_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
hs |
MU11KSUBA:L76223_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MG-U74AV2:95672_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MG-U74CV2:169535_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MOE430A:1416291_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MOUSE430A_2:1416291_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MOUSE430_2:1416291_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MOE430A:1416290_A_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MOUSE430A_2:1416290_A_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MOUSE430_2:1416290_A_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
mm |
MU19KSUBB:TC30535_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA (cDNA clone IMAGE:3501138) |
mm |
RG-U34A:D50695_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
rn |
RAE230A:1398869_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
rn |
RAT230_2:1398869_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
rn |
RAE230B:1391768_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
rn |
RAT230_2:1391768_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
rn |
RAE230B:1381794_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
rn |
RAT230_2:1381794_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
rn |
YEAST_2:1779196_AT |
One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degradation of ubiquitinated substrates; substrate of N-acetyltransferase B |
Sc | |
|
|
|
|
|
30163 |
protein catabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
5737 |
cytoplasm |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
166 |
nucleotide binding |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
16787 |
hydrolase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
NP_498429 |
proteasome Regulatory Particle, ATPase-like family member (rpt-3) [Caenorhabditis elegans] gb|AAA20608.1| Proteasome regulatory particle, atpase-like protein 3 [Caenorhabditis elegans] sp|P46502|PRS6B_CAEEL Probable 26S protease regulatory subunit 6B |
0.0 |
blast |
CAE64409 |
Hypothetical protein CBG09101 [Caenorhabditis briggsae] |
0.0 |
blast |
CAE61029 |
Hypothetical protein CBG04772 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR003959 EMBL-EBI |
AAA ATPase, central region |
7.2E-88 |
Pfam |
IPR003959 EMBL-EBI |
AAA ATPase, central region |
7.2E-88 | |
Sequence |
|
>C. ELEGANS:188631_AT
ctgcaaatactgctgcttccttcattcgcgttgttggatctgagtttgtacagaaatatc
ttggagaaggaccacgaatggtgcgtgacgtcttccgtctggcaaaggaaaacagcccat
ctattatttttatcgatgaaattgacgcgattgctacgaaacgtttcgatgctcaaaccg
gagcagatcgtgaggttcaacgtattcttctcgaattgctcaatcaaatggacggttttg
atcaaagcactaatgtgaaagttatcatggccactaatcgacaggatactctcgatcctg
cacttcttcgtccaggtcgtctcgatcgtaagattgagttcccattgccagatcgtcgtc
aaaagcgtctcgtattctcaaccgtctgctctcgtatgaacctgtcggatgatgttgatt
tggaagactgggttgctcgtccagacaagatttcaggagctgatatcaactctatctgtc
aagaagctggtatgcaagccgttcgtgagaatcgttacgttgtgcttaccaag
BLASTn GenBank NR |
|
|
|
|
|
|
CTGCAAATACTGCTGCTTCCTTCAT |
141 |
237 |
659 |
Antisense |
CTTCCTTCATTCGCGTTGTTGGATC |
374 |
219 |
674 |
Antisense |
ACGAATGGTGCGTGACGTCTTCCGT |
692 |
91 |
732 |
Antisense |
GAGGTTCAACGTATTCTTCTCGAAT |
648 |
401 |
850 |
Antisense |
GTTATCATGGCCACTAATCGACAGG |
492 |
445 |
919 |
Antisense |
AAGATTGAGTTCCCATTGCCAGATC |
573 |
155 |
988 |
Antisense |
CAAAAGCGTCTCGTATTCTCAACCG |
49 |
191 |
1018 |
Antisense |
GCTCTCGTATGAACCTGTCGGATGA |
15 |
301 |
1046 |
Antisense |
GGAAGACTGGGTTGCTCGTCCAGAC |
79 |
531 |
1080 |
Antisense |
GAAGCTGGTATGCAAGCCGTTCGTG |
388 |
343 |
1141 |
Antisense |
GAATCGTTACGTTGTGCTTACCAAG |
533 |
329 |
1167 |
Antisense | |
|
Affymetrix Proprietary Database | |