|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
188605_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.12295
|
|
Exemplar sequence
|
|
B0024.14 NCBI
|
|
B0024.14 /REP_DB=WormBase Gene ID /WP=CE25737 /GB=CAC35857.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=pro-collagen domains
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_171530(11), NM_171935(11), NM_171529(11) |
|
|
|
|
|
NM_171530 NCBI |
Caenorhabditis elegans CRiM (Cysteine RIch motor neuron protein) homolog family member (crm-1) (crm-1) mRNA, complete cds. |
11/11 |
None |
NM_171935 NCBI |
Caenorhabditis elegans CRiM (Cysteine RIch motor neuron protein) homolog family member (crm-1) (crm-1) mRNA, complete cds. |
11/11 |
None |
NM_171529 NCBI |
Caenorhabditis elegans CRiM (Cysteine RIch motor neuron protein) homolog family member (crm-1) (crm-1) mRNA, complete cds. |
11/11 |
None |
SNAP00000027140 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:10325149:10326181:-1 |
10/11 |
None |
GENEFINDER00000027148 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:10325149:10329023:-1 |
11/11 |
None |
B0024.14a ENSEMBL |
cdna:known chromosome:CEL140:V:10324875:10331830:-1 gene:B0024.14 |
11/11 |
None |
B0024.14d ENSEMBL |
cdna:known chromosome:CEL140:V:10324897:10331830:-1 gene:B0024.14 |
11/11 |
None |
B0024.14b ENSEMBL |
cdna:known chromosome:CEL140:V:10325149:10334692:-1 gene:B0024.14 |
11/11 |
None | |
NM_171531 |
5/11 |
Cross Hyb Matching Probes |
None |
NM_001026172 |
4/11 |
Cross Hyb Matching Probes |
None |
B0024.14c.1 |
5/11 |
Cross Hyb Matching Probes |
None |
B0024.14e |
4/11 |
Cross Hyb Matching Probes |
None | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:10325148-10329023(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
B0024.14
|
Functional Annotations |
|
|
|
|
|
blast |
CAC35857 |
Hypothetical protein B0024.14a [Caenorhabditis elegans] emb|CAA94886.3| Hypothetical protein B0024.14a [Caenorhabditis elegans] ref|NP_741617.1| CRiM (Cysteine RIch motor neuron protein) homolog family member (crm-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAF32233 |
Hypothetical protein B0024.14d [Caenorhabditis elegans] emb|CAD44089.1| Hypothetical protein B0024.14d [Caenorhabditis elegans] ref|NP_741618.1| CRiM (Cysteine RIch motor neuron protein) homolog family member (crm-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAD44140 |
Hypothetical protein B0024.14b [Caenorhabditis elegans] emb|CAD44087.1| Hypothetical protein B0024.14b [Caenorhabditis elegans] ref|NP_741616.1| CRiM (Cysteine RIch motor neuron protein) homolog family member (crm-1) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
3.2E-9 |
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
8.7E-5 |
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
7.7E-8 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
8.2E-9 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
3.4E-8 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
3.7E-12 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
1.8E-10 |
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
3.2E-9 |
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
8.7E-5 |
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
7.7E-8 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
8.2E-9 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
3.4E-8 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
3.7E-12 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
1.8E-10 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
1.8E-10 |
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
3.2E-9 |
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
8.7E-5 |
Pfam |
IPR004094 EMBL-EBI |
Antistasin |
7.7E-8 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
8.2E-9 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
3.4E-8 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
3.7E-12 |
Pfam |
IPR001007 EMBL-EBI |
von Willebrand factor, type C |
1.8E-10 |
NP_741617.1 |
1 |
760-782 |
NP_741618.1 |
1 |
760-782 |
NP_741616.1 |
1 |
826-848 |
B0024.14a |
1 |
760-782 |
B0024.14d |
1 |
760-782 |
B0024.14b |
1 |
826-848 |
SNAP00000027140 |
1 |
162-184 |
GENEFINDER00000027148 |
1 |
741-763 | |
Sequence |
|
>C. ELEGANS:188605_S_AT
gtctgtcgtcagatggtttgtccacattgtgatgatcctgtaccaattgaaggacattgt
tgtccgctttgcaaagatgcaaaatggtctccatatggttatggaaatggttcagcatca
ttcccaacttctcttggaccaagagtggatgatggaaatggaagctctgctacttcgctg
attgttgtatctctgatgtctctttgcgtcgttgctctcattattgtgcttatgcttctc
tataaacgaaataagaaaagcaacaagctgcacaagttcaacgaagtcggccaaatagca
tcggggggagcatcaacagtaagactttcagcgtcaaaaacaattggatccatgccaaga
ctcgtggattggaaggacacgagagaagagtatgtaacacaaatcaaatactttattttt
aaaaaatatttcagaagtacggaggaattgttgaagacatcaactaatcatgttcgacac
gactcgcagaattcagatgatcaatcagacagtttgctttctacaatgagtgatacttcg
acagcaccttct
BLASTn GenBank NR |
|
|
|
|
|
|
GTCTGTCGTCAGATGGTTTGTCCAC |
613 |
471 |
2041 |
Antisense |
GACATTGTTGTCCGCTTTGCAAAGA |
93 |
371 |
2093 |
Antisense |
AATGGTTCAGCATCATTCCCAACTT |
668 |
159 |
2146 |
Antisense |
CTCTGCTACTTCGCTGATTGTTGTA |
685 |
231 |
2205 |
Antisense |
TTGTATCTCTGATGTCTCTTTGCGT |
650 |
707 |
2225 |
Antisense |
CGTCGTTGCTCTCATTATTGTGCTT |
94 |
247 |
2247 |
Antisense |
ATTATTGTGCTTATGCTTCTCTATA |
87 |
15 |
2260 |
Antisense |
GAAGTCGGCCAAATAGCATCGGGGG |
73 |
337 |
2323 |
Antisense |
TTGGATCCATGCCAAGACTCGTGGA |
220 |
709 |
2384 |
Antisense |
GACACGACTCGCAGAATTCAGATGA |
660 |
365 |
2516 |
Antisense |
GAGTGATACTTCGACAGCACCTTCT |
599 |
401 |
2568 |
Antisense | |
|
Affymetrix Proprietary Database |