|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
188494_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.459
|
|
Exemplar sequence
|
|
F08B6.4 NCBI
|
|
F08B6.4 /REP_DB=WormBase Gene ID /WP=CE20658 /CHR=1 /FEA=Sanger Annotation /DEF=calponin (ST.LOUIS) TR:Q9TYS6 protein_id:AAC78234.1
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001025923(11), NM_001025922(11), NM_001025921(11), U04711(11) |
|
|
|
|
|
NM_001025923 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-87) (unc-87) mRNA, complete cds. |
11/11 |
None |
NM_001025922 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-87) (unc-87) mRNA, complete cds. |
11/11 |
None |
NM_001025921 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-87) (unc-87) mRNA, complete cds. |
11/11 |
None |
U04711 NCBI |
Caenorhabditis elegans N2 (unc-87) mRNA, complete cds. |
11/11 |
A |
SNAP00000014331 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:6769901:6773744:-1 |
11/11 |
None |
GENEFINDER00000014337 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:6770773:6773744:-1 |
11/11 |
None |
F08B6.4c.3 ENSEMBL |
cdna:known chromosome:CEL140:I:6769362:6775931:-1 gene:F08B6.4 |
11/11 |
A |
F08B6.4c.2 ENSEMBL |
cdna:known chromosome:CEL140:I:6769362:6773745:-1 gene:F08B6.4 |
11/11 |
A |
F08B6.4c.1 ENSEMBL |
cdna:known chromosome:CEL140:I:6769362:6773846:-1 gene:F08B6.4 |
11/11 |
A |
F08B6.4b.1 ENSEMBL |
cdna:known chromosome:CEL140:I:6769701:6775931:-1 gene:F08B6.4 |
11/11 |
None |
F08B6.4a ENSEMBL |
cdna:known chromosome:CEL140:I:6769901:6773744:-1 gene:F08B6.4 |
11/11 |
A |
F08B6.4b.2 ENSEMBL |
cdna:known chromosome:CEL140:I:6769901:6775933:-1 gene:F08B6.4 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:6769829-6773673(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
F08B6.4
|
Functional Annotations |
|
|
|
|
|
blast |
AAT68897 |
Uncoordinated protein 87, isoform c [Caenorhabditis elegans] ref|NP_001021094.1| UNCoordinated family member (unc-87) [Caenorhabditis elegans] |
0.0 |
blast |
AAC78234 |
Uncoordinated protein 87, isoform a [Caenorhabditis elegans] ref|NP_001021092.1| UNCoordinated family member (unc-87) [Caenorhabditis elegans] pir||T33851 thin filament-associated protein UNC-87, long form - Caenorhabditis elegans gb|AAA81902.1| one of two alternatively spliced products |
0.0 |
blast |
P37806 |
Uncoordinated protein 87 (Protein unc-87) |
0.0 |
blast |
AAK68303 |
Uncoordinated protein 87, isoform b [Caenorhabditis elegans] ref|NP_001021093.1| UNCoordinated family member (unc-87) [Caenorhabditis elegans] gb|AAA81901.1| uses the first of two potential start codons; second of two alternatively spliced products gb|AAA81899.1| uses first of two potential start sites |
0.0 | |
|
|
|
|
|
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.4E-4 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
2.3E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
4.2E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.0E-10 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
5.5E-9 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
3.8E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
7.0E-5 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.4E-4 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
2.3E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
4.2E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.0E-10 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
5.5E-9 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
3.8E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
7.0E-5 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.4E-4 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
2.3E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
4.2E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.0E-10 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
5.5E-9 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
3.8E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
7.0E-5 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.4E-4 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
2.3E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
4.2E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
1.0E-10 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
5.5E-9 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
3.8E-8 |
Pfam |
IPR000557 EMBL-EBI |
Calponin repeat |
7.0E-5 | |
Sequence |
|
>C. ELEGANS:188494_S_AT
ggaactggacgtcgtgagacaactaagatggttgactcaaagcatccagaatacgatcac
gagaaaccagatcaatctgaaattccacttcagtctggaacaaacaaattcgcttcacaa
aagggaatgaccggtttcggaactgctcgtcgtgagaccacaaagatggttgattctaac
catccagattactctcatgaatgttccattgatcaaaccacaattccatctcagatggga
tctaatcaatatgcttcacagaagggtatgactggattcggacagccacgttgggaagtt
ctcgacccatcaatctcatggcaaaaccgtaaatcccagggaatggtccgtcttcaatct
ggtaccaaccgttttgcttctcaagctggtatgattggcttcggaacatgca
BLASTn GenBank NR |
|
|
|
|
|
|
GGAACTGGACGTCGTGAGACAACTA |
95 |
529 |
1081 |
Antisense |
GGTTGACTCAAAGCATCCAGAATAC |
457 |
507 |
1110 |
Antisense |
GTTTCGGAACTGCTCGTCGTGAGAC |
269 |
449 |
1214 |
Antisense |
GATTCTAACCATCCAGATTACTCTC |
108 |
431 |
1252 |
Antisense |
TCAAACCACAATTCCATCTCAGATG |
524 |
629 |
1293 |
Antisense |
ATGACTGGATTCGGACAGCCACGTT |
38 |
39 |
1348 |
Antisense |
GCCACGTTGGGAAGTTCTCGACCCA |
624 |
279 |
1365 |
Antisense |
TCTCGACCCATCAATCTCATGGCAA |
362 |
611 |
1380 |
Antisense |
AATGGTCCGTCTTCAATCTGGTACC |
6 |
161 |
1422 |
Antisense |
ATCTGGTACCAACCGTTTTGCTTCT |
201 |
23 |
1437 |
Antisense |
GGTATGATTGGCTTCGGAACATGCA |
166 |
503 |
1468 |
Antisense | |
|
Affymetrix Proprietary Database |