|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
188372_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.8840
|
|
Exemplar sequence
|
|
F54E12.2 NCBI
|
|
F54E12.2 /REP_DB=WormBase Gene ID /WP=CE11083 /TR=O17550 /GB=CAB05213.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=helicase
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_069736(11) |
|
|
|
|
|
NM_069736 NCBI |
Caenorhabditis elegans F54E12.2 (helicase) mRNA, complete cds. |
11/11 |
None |
F54E12.2.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:11333070:11336836:-1 gene:F54E12.2 |
11/11 |
None |
F54E12.2.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:11333122:11337155:-1 gene:F54E12.2 |
11/11 |
None | |
SNAP00000002620 |
4/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000002633 |
4/11 |
Cross Hyb Matching Probes |
None |
SNAP00000035843 |
2/11 |
Cross Hyb Matching Probes |
None | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:11333218-11336840(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
helicase
|
|
F54E12.2
|
|
178054 Entrez gene
|
|
O17550 EMBL-EBI
|
|
CE11083 Wormbase
|
Functional Annotations |
|
|
|
|
DROSGENOME1:143236_AT |
lodestar |
dm |
DROSOPHILA_2:1634695_AT |
lodestar |
dm |
CHICKEN:GGA.10062.1.S1_S_AT |
similar to transcription termination factor, RNA polymerase II; lodestar protein; human factor 2 |
gga |
CHICKEN:GGAAFFX.24633.1.S1_AT |
similar to transcription termination factor, RNA polymerase II; lodestar protein; human factor 2 |
gga |
CHICKEN:GGAAFFX.9706.1.S1_AT |
similar to transcription termination factor, RNA polymerase II; lodestar protein; human factor 2 |
gga |
HG-U95AV2:37870_AT |
transcription termination factor, RNA polymerase II |
hs |
HG-U133A:204407_AT |
transcription termination factor, RNA polymerase II |
hs |
HG-U133_PLUS_2:204407_AT |
transcription termination factor, RNA polymerase II |
hs |
HG-FOCUS:204407_AT |
transcription termination factor, RNA polymerase II |
hs |
HG-U133A_2:204407_AT |
transcription termination factor, RNA polymerase II |
hs |
U133_X3P:G5733121_3P_AT |
transcription termination factor, RNA polymerase II |
hs |
U133_X3P:1555307_3P_AT |
transcription termination factor, RNA polymerase II |
hs |
HG-U133_PLUS_2:1555307_AT |
transcription termination factor, RNA polymerase II |
hs |
HG-U95E:75654_AT |
transcription termination factor, RNA polymerase II |
hs |
HG-U95E:88165_R_AT |
transcription termination factor, RNA polymerase II |
hs |
HG-U95D:69123_AT |
Transcription termination factor, RNA polymerase II |
hs |
MOE430B:1452818_AT |
transcription termination factor, RNA polymerase II |
mm |
MOUSE430_2:1452818_AT |
transcription termination factor, RNA polymerase II |
mm |
MG-U74BV2:108314_AT |
transcription termination factor, RNA polymerase II |
mm |
MG-U74BV2:163889_AT |
transcription termination factor, RNA polymerase II |
mm |
MOE430B:1428522_AT |
transcription termination factor, RNA polymerase II |
mm |
MOUSE430_2:1428522_AT |
transcription termination factor, RNA polymerase II |
mm |
MU19KSUBA:TC18946_AT |
transcription termination factor, RNA polymerase II |
mm |
MU19KSUBB:TC32664_R_AT |
transcription termination factor, RNA polymerase II |
mm |
RAE230B:1382656_AT |
transcription termination factor, RNA polymerase II (predicted) |
rn |
RAT230_2:1382656_AT |
transcription termination factor, RNA polymerase II (predicted) |
rn |
RAE230B:1393521_AT |
Transcription termination factor, RNA polymerase II (predicted) |
rn |
RAT230_2:1393521_AT |
Transcription termination factor, RNA polymerase II (predicted) |
rn |
RG-U34C:RC_AI232280_AT |
Transcription termination factor, RNA polymerase II (predicted) |
rn | |
|
|
|
|
|
3676 |
nucleic acid binding |
inferred from electronic annotation |
QuickGO AmiGO |
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO |
4386 |
helicase activity |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
8026 |
ATP-dependent helicase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA97421 |
Hypothetical protein F54E12.2 [Caenorhabditis elegans] emb|CAB05213.1| Hypothetical protein F54E12.2 [Caenorhabditis elegans] ref|NP_502137.1| F54E12.2 [Caenorhabditis elegans] |
0.0 |
blast |
CAE60366 |
Hypothetical protein CBG03965 [Caenorhabditis briggsae] |
0.0 |
blast |
CAE67662 |
Hypothetical protein CBG13225 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR000330 EMBL-EBI |
SNF2 related domain |
4.0E-60 |
Pfam |
IPR001650 EMBL-EBI |
Helicase, C-terminal |
4.6E-20 | |
Sequence |
|
>C. ELEGANS:188372_S_AT
gagacaaaccgagggctacaacacgaattttcgatccggactacctgagctgtaaaatta
aaaatacacttgaaattgttgagaacattatggagaagaaagagaaagttgtcattgttt
ctcaatggacatcggttctcaatttgatcgaaattcacataaaatcaagtggtttcaaat
atacatcaattaccggacaagttctggtcaaggatcgtcaagagagagtggacagcttta
atcgggagaaaggtggtgctcgagttatgcttctctctctggccgcgggaggtgttgggc
tcaatctgacaggtggaaatcatttagtgatggtggatttgcattggaatccggctctcg
aacagcaagctttcg
BLASTn GenBank NR |
|
|
|
|
|
|
GAGACAAACCGAGGGCTACAACACG |
163 |
383 |
2711 |
Antisense |
CACGAATTTTCGATCCGGACTACCT |
229 |
39 |
2732 |
Antisense |
GATCCGGACTACCTGAGCTGTAAAA |
250 |
417 |
2743 |
Antisense |
GTTTCTCAATGGACATCGGTTCTCA |
249 |
451 |
2827 |
Antisense |
TACATCAATTACCGGACAAGTTCTG |
160 |
643 |
2892 |
Antisense |
ACAAGTTCTGGTCAAGGATCGTCAA |
423 |
111 |
2907 |
Antisense |
GAGAGTGGACAGCTTTAATCGGGAG |
427 |
395 |
2934 |
Antisense |
AGGTGGTGCTCGAGTTATGCTTCTC |
24 |
59 |
2961 |
Antisense |
GCGGGAGGTGTTGGGCTCAATCTGA |
139 |
293 |
2995 |
Antisense |
TTTGCATTGGAATCCGGCTCTCGAA |
460 |
667 |
3048 |
Antisense |
CCGGCTCTCGAACAGCAAGCTTTCG |
110 |
267 |
3061 |
Antisense | |
|
Affymetrix Proprietary Database |