|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
188150_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.4787
|
|
Exemplar sequence
|
|
K07D4.3 NCBI
|
|
K07D4.3 /REP_DB=WormBase Gene ID /WP=CE19527 /GEN=rpn-11 /TR=O76577 /GB=AAC26287.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_062311(11) |
|
|
|
|
|
NM_062311 NCBI |
Caenorhabditis elegans proteasome Regulatory Particle, Non-ATPase-like family member (rpn-11) (rpn-11) mRNA, complete cds. |
11/11 |
None |
SNAP00000021601 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:4039100:4044318:-1 |
11/11 |
None |
GENEFINDER00000021608 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:4043211:4044318:-1 |
11/11 |
None |
K07D4.3.2 ENSEMBL |
cdna:known chromosome:CEL140:II:4043055:4044331:-1 gene:K07D4.3 |
11/11 |
None |
K07D4.3.1 ENSEMBL |
cdna:known chromosome:CEL140:II:4043055:4044324:-1 gene:K07D4.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:4043209-4044317(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
rpn-11
|
|
K07D4.3
|
|
173744 Entrez gene
|
|
O76577 EMBL-EBI
|
|
CE19527 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:249796_AT |
26S proteasome regulatory subunit, putative |
at |
CANINE:1586807_AT |
similar to proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
cfa |
CANINE_2:CFA.10188.1.S1_AT |
similar to proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
cfa |
CANINE_2:CFAAFFX.15655.1.S1_S_AT |
similar to proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
cfa |
DROSOPHILA_2:1628531_AT |
|
dm |
DROSGENOME1:144247_AT |
|
dm |
CHICKEN:GGA.5295.1.S1_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
gga |
CHICKEN:GGAAFFX.12702.1.S1_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
gga |
HU35KSUBC:RC_T86751_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HU35KSUBC:RC_AA621752_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HUGENEFL:U86782_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
U133_X3P:HS.178761.0.S1_3P_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HG-U133A_2:212296_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HG-FOCUS:212296_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HG-U133_PLUS_2:212296_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HG-U133A:212296_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HG-U95AV2:33247_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HG-U95B:43809_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
HG-U95D:87461_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
hs |
MOUSE430_2:1421751_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
mm |
MOUSE430A_2:1421751_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
mm |
MOE430A:1421751_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
mm |
MU11KSUBB:Y13071_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
mm |
MG-U74AV2:97274_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
mm |
MOUSE430_2:1459734_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA (cDNA clone MGC:5840 IMAGE:3599671) |
mm |
MOE430B:1459734_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA (cDNA clone MGC:5840 IMAGE:3599671) |
mm |
MOUSE430_2:1446521_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA (cDNA clone MGC:5840 IMAGE:3599671) |
mm |
MOE430B:1446521_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA (cDNA clone MGC:5840 IMAGE:3599671) |
mm |
MG-U74BV2:105181_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA (cDNA clone MGC:5840 IMAGE:3599671) |
mm |
MOUSE430_2:1457765_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA (cDNA clone MGC:5840 IMAGE:3599671) |
mm |
MOE430B:1457765_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA (cDNA clone MGC:5840 IMAGE:3599671) |
mm |
MU19KSUBB:TC33835_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA (cDNA clone MGC:5840 IMAGE:3599671) |
mm |
YEAST_2:1770323_AT |
Metalloprotease subunit of the 19S regulatory particle of the 26S proteasome lid; couples the deubiquitination and degradation of proteasome substrates |
Sc | |
|
|
|
|
|
5838 |
proteasome regulatory particle (sensu Eukaryota) |
inferred from sequence similarity |
QuickGO AmiGO |
|
|
|
|
5515 |
protein binding |
inferred from physical interaction |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAC26287 |
Proteasome regulatory particle, non-atpase-like protein 11 [Caenorhabditis elegans] ref|NP_494712.1| proteasome Regulatory Particle, Non-ATPase-like family member (rpn-11) [Caenorhabditis elegans] sp|O76577|PSDE_CAEEL 26S proteasome non-ATPase regulatory subunit 14 (26S proteasome regulatory subunit rpn11) |
1.0E-166 |
blast |
CAE56296 |
Hypothetical protein CBG23950 [Caenorhabditis briggsae] |
1.0E-162 |
blast |
AAC26287 |
Proteasome regulatory particle, non-atpase-like protein 11 [Caenorhabditis elegans] ref|NP_494712.1| proteasome Regulatory Particle, Non-ATPase-like family member (rpn-11) [Caenorhabditis elegans] sp|O76577|PSDE_CAEEL 26S proteasome non-ATPase regulatory subunit 14 (26S proteasome regulatory subunit rpn11) |
1.0E-161 |
blast |
CAE56296 |
Hypothetical protein CBG23950 [Caenorhabditis briggsae] |
1.0E-157 | |
|
|
|
|
|
Pfam |
IPR000555 EMBL-EBI |
Peptidase M67, Mov34 |
6.0E-49 | |
Sequence |
|
>C. ELEGANS:188150_S_AT
gtcgtcggatggtaccattcccatccaggattcggatgttggctctccggcgtcgacatc
aacactcagcagtcgtttgaagcgctttccgacagagctgtcgccgttgtcgtcgacccg
attcaatctgtgaagggaaaggttgtgatcgacgcgttccgtacgatcaacccacaatcg
atggctttaaatcaagaaccacgtcaaactaccagtaatttgggtcatttgcagaagccg
agcattcaggccctaatccacggactcaatcgtcactactactccatcccaatcgcctac
agaacccacgaccttgaacagaagatgctcttgaatcttaacaagctctcatggatggac
gcagtcagcgtcgaaaactactcaaaatgcggtgaacagaacaaggagcacctcaaggcg
atgctcaagctcgccaagaactacaag
BLASTn GenBank NR |
|
|
|
|
|
|
GTCGTCGGATGGTACCATTCCCATC |
298 |
473 |
340 |
Antisense |
TCCAGGATTCGGATGTTGGCTCTCC |
86 |
591 |
363 |
Antisense |
GACATCAACACTCAGCAGTCGTTTG |
368 |
369 |
394 |
Antisense |
TGAAGCGCTTTCCGACAGAGCTGTC |
99 |
575 |
417 |
Antisense |
AAAGGTTGTGATCGACGCGTTCCGT |
247 |
121 |
477 |
Antisense |
GATCAACCCACAATCGATGGCTTTA |
50 |
423 |
504 |
Antisense |
AGAACCACGTCAAACTACCAGTAAT |
606 |
73 |
534 |
Antisense |
TGCAGAAGCCGAGCATTCAGGCCCT |
175 |
579 |
569 |
Antisense |
ATCCACGGACTCAATCGTCACTACT |
344 |
39 |
595 |
Antisense |
CACCTCAAGGCGATGCTCAAGCTCG |
661 |
201 |
748 |
Antisense |
GCTCAAGCTCGCCAAGAACTACAAG |
535 |
301 |
762 |
Antisense | |
|
Affymetrix Proprietary Database | |