[Home] | [Total List]

[187994_at]

Description F12F3.2 /REP_DB=WormBase Gene ID /WP=CE09360 /TR=P91255 /GB=AAC25886.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=titin
Cluster 6grp_highest_10_10 > 32      6grp_high1_10_10 > 13      4grp_high_8_8 > 33      6grp_highest_nonorm > 41      6grp_total > 12      4grp_total > 46      6grp_highest_sub > De      6grp_cgc > 33      6grp_high1_sub > De      6grp_cgc_sub > De      6grp_total_sub > Hat      6grp_rule_based > S2      4grp_rule_based > L1      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1387
1 2 3 4 range
A 1439.9
(3)
P 		476.9
(-1.5)
P 		150.5
(-3)
M 		294
(-2.3)
P 		1289
B 1537.9
(3)
P 		562.6
(-1.3)
P 		166.3
(-3)
P 		379.3
(-2.1)
P 		1372
C 1488.7
(3)
P 		399.9
(-2.1)
P 		205.9
(-3)
P 		296.4
(-2.6)
P 		1283
avr 1488.8
(3) 		479.8
(-1.6) 		174.2
(-3) 		323.2
(-2.3) 		1315

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1126
1 2 3 4 5 6 range
A 607.1
(-1.1)
P 		1380
(3)
P 		574.4
(-1.3)
P 		498.4
(-1.7)
P 		254.1
(-3)
P 		264.7
(-2.9)
P 		1126
B 989.8
(3)
P 		836.1
(1.7)
P 		758.7
(1.1)
P 		505.2
(-1.1)
P 		322.3
(-2.6)
P 		277
(-3)
P 		713
C 902.6
(1.8)
P 		1054.7
(3)
P 		919
(1.9)
P 		343
(-2.6)
P 		354.3
(-2.5)
P 		291.4
(-3)
P 		763
avr 833.2
(1.1) 		1090.3
(3) 		750.7
(0.5) 		448.9
(-1.7) 		310.2
(-2.8) 		277.7
(-3) 		813
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 486
1 2 3 4 range
A 524.3
(3)
P 		103.5
(-2.2)
P 		39.3
(-3)
M 		43
(-3)
P 		485
B 490.4
(3)
P 		138.9
(-1.7)
P 		38.5
(-3)
P 		80.8
(-2.4)
P 		452
C 492.8
(3)
P 		115
(-2.1)
P 		71.8
(-2.7)
P 		50
(-3)
P 		443
avr 502.5
(3) 		119.1
(-2.1) 		49.9
(-3) 		57.9
(-2.9) 		453

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 426
1 2 3 4 5 6 range
A 111.9
(-2.3)
P 		490.8
(3)
P 		125.1
(-2.1)
P 		126.4
(-2.1)
P 		76.7
(-2.8)
P 		64.4
(-3)
P 		426
B 344.4
(3)
P 		278.3
(1.4)
P 		184.2
(-1)
P 		133.8
(-2.2)
P 		130.9
(-2.3)
P 		103.3
(-3)
P 		241
C 334.6
(3)
P 		321.8
(2.7)
P 		233.9
(0.7)
P 		69
(-3)
P 		114.6
(-2)
P 		97.6
(-2.4)
P 		266
avr 263.6
(0.8) 		363.6
(3) 		181.1
(-1) 		109.7
(-2.5) 		107.4
(-2.6) 		88.4
(-3) 		275
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 187994_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.11891
Sequence Type Exemplar sequence
Representative Public ID F12F3.2 NCBI
Target Description F12F3.2 /REP_DB=WormBase Gene ID /WP=CE09360 /TR=P91255 /GB=AAC25886.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=titin
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_001029031(10), NM_001029033(10), NM_001029032(10)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_001029031 NCBI Caenorhabditis elegans Temporarily Assigned Gene name family member (tag-58) (tag-58) mRNA, complete cds. 10/11 None
NM_001029033 NCBI Caenorhabditis elegans Temporarily Assigned Gene name family member (tag-58) (tag-58) mRNA, complete cds. 10/11 None
NM_001029032 NCBI Caenorhabditis elegans Temporarily Assigned Gene name family member (tag-58) (tag-58) mRNA, complete cds. 10/11 None
SNAP00000025064 ENSEMBL cdna:SNAP chromosome:CEL140:V:6124171:6133768:-1 10/11 None
GENEFINDER00000025079 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:6124171:6137993:-1 10/11 None
W06H8.8e ENSEMBL cdna:known chromosome:CEL140:V:6123860:6205127:-1 gene:W06H8.8 10/11 A 
W06H8.8g ENSEMBL cdna:known chromosome:CEL140:V:6123881:6205127:-1 gene:W06H8.8 10/11 A 
W06H8.8f ENSEMBL cdna:known chromosome:CEL140:V:6124187:6205127:-1 gene:W06H8.8 10/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
266969 7 3 NM_001029029 183162_at (11)
NM_001029030 176443_s_at (10), 183162_at (11), 185778_at (11)
NM_001029031 174345_at (11), 176443_s_at (10), 183162_at (11), 185778_at (11), 187965_s_at (11), 187994_at (10)
NM_001029032 176443_s_at (10), 183162_at (11), 185778_at (11), 187965_s_at (11), 187994_at (10)
NM_001029033 174345_at (11), 176443_s_at (10), 183162_at (11), 185778_at (11), 187965_s_at (11), 187994_at (10)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:6124298-6135778(-) 99.25 100.0
Public Domain and Genome References
Ensembl W06H8.8
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast NP_001024202 Temporarily Assigned Gene name family member (tag-58) [Caenorhabditis elegans] gb|AAN61517.1| 2MDa_1 protein [Caenorhabditis elegans] 0.0
blast NP_001024204 Temporarily Assigned Gene name family member (tag-58) [Caenorhabditis elegans] 0.0
blast NP_001024203 Temporarily Assigned Gene name family member (tag-58) [Caenorhabditis elegans] gb|AAN61518.1| 2MDa_2 protein [Caenorhabditis elegans] 0.0
Protein Families
Method ID Description E-Value
ec A2S7_HUMAN (Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) 4.0E-59
ec A2S7_HUMAN (Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) 1.0E-52
ec A2S7_HUMAN (Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) 1.0E-53
hanks 2.1.17 CaMK Group; CaMK I Regulated by Ca2+/CaM and close relatives; TWITCH 5.0E-85
hanks 2.1.17 CaMK Group; CaMK I Regulated by Ca2+/CaM and close relatives; TWITCH 3.0E-85
Protein Domains
Database ID Description E-Value
scop a.2.7.Phenylalanyl-tRNA synthetase (PheRS) All alpha proteins; Long alpha-hairpin; tRNA-binding arm; Phenylalanyl-tRNA synthetase (PheRS) 4.30000019073486
scop a.2.7.Phenylalanyl-tRNA synthetase (PheRS) All alpha proteins; Long alpha-hairpin; tRNA-binding arm; Phenylalanyl-tRNA synthetase (PheRS) 4.19999980926514
Pfam IPR003961 EMBL-EBI Fibronectin, type III 9.3E-14
Pfam IPR003961 EMBL-EBI Fibronectin, type III 1.4E-17
Pfam IPR003961 EMBL-EBI Fibronectin, type III 4.3E-16
Pfam IPR003961 EMBL-EBI Fibronectin, type III 1.7E-11
Pfam IPR003961 EMBL-EBI Fibronectin, type III 7.4E-10
Pfam IPR003961 EMBL-EBI Fibronectin, type III 1.0E-14
Pfam IPR003961 EMBL-EBI Fibronectin, type III 7.9E-12
Pfam IPR003961 EMBL-EBI Fibronectin, type III 2.3E-6
Pfam IPR003961 EMBL-EBI Fibronectin, type III 2.4E-17
Pfam IPR003961 EMBL-EBI Fibronectin, type III 1.4E-12
Pfam IPR000719 EMBL-EBI Protein kinase 2.2E-83
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0015
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.017
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.5E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.093
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0041
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 6.7E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.077
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 5.3E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0026
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.2
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.89
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.48
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.15
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.1
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 9.2E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0025
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.7E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 8.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 5.2E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0022
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.15
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.022
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 6.4E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0017
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 8.4E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.1E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.71
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.8E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.4E-10
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0037
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.4E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.0E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.012
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0084
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.5E-5
Pfam IPR003961 EMBL-EBI Fibronectin, type III 1.4E-12
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.022
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 6.4E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0017
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 8.4E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.1E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.71
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.8E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.4E-10
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0037
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.4E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.0E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.012
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0084
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.5E-5
Pfam IPR003961 EMBL-EBI Fibronectin, type III 2.4E-17
Pfam IPR003961 EMBL-EBI Fibronectin, type III 1.4E-12
Pfam IPR000719 EMBL-EBI Protein kinase 2.2E-83
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.022
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 6.4E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0017
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 8.4E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.1E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.71
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.8E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.4E-10
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0037
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.4E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.0E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.012
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.5E-5
Pfam IPR003961 EMBL-EBI Fibronectin, type III 2.4E-17
Pfam IPR003961 EMBL-EBI Fibronectin, type III 1.4E-12
Pfam IPR000719 EMBL-EBI Protein kinase 2.2E-83
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.022
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 6.4E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.5E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0017
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 8.4E-9
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.1E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.71
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.8E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.4E-10
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0037
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.4E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.0E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.012
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0084
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.5E-5
Sequence
Target Sequence 
>C. ELEGANS:187994_AT
gagccaacaaccagatcagatccaggtgtcagcgtcgagctgcgcgctaaagttatcgga
cacccggatccaatgagaaacgaaggtgacaagttcattcttcgaatcgcaaacgtaact
cgcgcagatgctggaaagtatgaattgactgcgatcaatccatccggacaggcaaatgca
gagttagaactgactgttgtacaatctacaaaaactgtcggagcaaaaccgaaattcaat
gagtcgccgatttcagtgcaaacgtgcgagaagaacagagcagagctgcgagcttcgttc
tctggcacacctgcccctgcatgtcgatggttctacaacggaaatgaattgattgatggt
ctcgatggatatacaattacatcatctgatactaattcatctctattaatcaattccgtt
gacaagaaacatttcggtgaatacctgtgcacaattcgtaaccagaacggtgaagagttg
gcgaatgcaatgattctatccgaaggtgagtgtcggaaacatcctagaattgatatcgtg
tttgtgtgtaactcgttcattttcagtgttgtccat

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GAGCCAACAACCAGATCAGATCCAG 279 385 7753 Antisense
ATCAGATCCAGGTGTCAGCGTCGAG 710 25 7767 Antisense
GAGCTGCGCGCTAAAGTTATCGGAC 286 387 7789 Antisense
TTATCGGACACCCGGATCCAATGAG 39 681 7805 Antisense
CAAACGTAACTCGCGCAGATGCTGG 558 191 7862 Antisense
CAATCCATCCGGACAGGCAAATGCA 424 181 7908 Antisense
GTCGCCGATTTCAGTGCAAACGTGC 536 473 7995 Antisense
AGAGCAGAGCTGCGAGCT