|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
187980_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2305
|
|
Exemplar sequence
|
|
R12E2.3 NCBI
|
|
R12E2.3 /REP_DB=WormBase Gene ID /WP=CE18135 /GEN=rpn-8 /TR=O61792 /GB=AAC17024.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_058918(11) |
|
|
|
|
|
NM_058918 NCBI |
Caenorhabditis elegans proteasome Regulatory Particle, Non-ATPase-like family member (rpn-8) (rpn-8) mRNA, complete cds. |
11/11 |
None |
SNAP00000012684 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:4175324:4177131:1 |
11/11 |
None |
GENEFINDER00000012696 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:4175324:4177131:1 |
11/11 |
None |
R12E2.3.1 ENSEMBL |
cdna:known chromosome:CEL140:I:4175318:4177252:1 gene:R12E2.3 |
11/11 |
None |
R12E2.3.2 ENSEMBL |
cdna:known chromosome:CEL140:I:4175320:4177252:1 gene:R12E2.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:4175323-4177131(+) |
91.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
rpn-8
|
|
R12E2.3
|
|
172009 Entrez gene
|
|
O61792 EMBL-EBI
|
|
CE18135 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:250749_AT |
26S proteasome non-ATPase regulatory subunit 7, putative / 26S proteasome regulatory subunit S12, putative / MOV34 protein, putative |
at |
CANINE:1584170_AT |
similar to 26S proteasome non-ATPase regulatory subunit 7 (26S proteasome regulatory subunit rpn8) (26S proteasome regulatory subunit S12) (Proteasome subunit p40) (Mov34 protein) |
cfa |
CANINE_2:CFA.20079.1.S1_S_AT |
similar to 26S proteasome non-ATPase regulatory subunit 7 (26S proteasome regulatory subunit rpn8) (26S proteasome regulatory subunit S12) (Proteasome subunit p40) (Mov34 protein) |
cfa |
CANINE_2:CFA.9159.1.A1_AT |
similar to 26S proteasome non-ATPase regulatory subunit 7 (26S proteasome regulatory subunit rpn8) (26S proteasome regulatory subunit S12) (Proteasome subunit p40) (Mov34 protein) |
cfa |
DROSOPHILA_2:1635259_AT |
Mov34 |
dm |
DROSGENOME1:143270_AT |
Mov34 |
dm |
CHICKEN:GGAAFFX.11938.1.S1_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
gga |
HG-U95AV2:945_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HC-G110:945_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U133_PLUS_2:201705_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U133A:201705_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-FOCUS:201705_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U133A_2:201705_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HU35KSUBA:D50063_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HUGENEFL:D50063_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
U133_X3P:G4506230_3P_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U95AV2:40276_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U133_PLUS_2:238738_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U133B:238738_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U133_PLUS_2:244515_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U133B:244515_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U95C:63133_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U95D:83443_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U95E:86457_F_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HG-U95E:86459_R_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
HU35KSUBC:RC_AA160805_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
U133_X3P:HS.177337.0.A1_3P_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
U133_X3P:HS.199832.0.A1_3P_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog) |
hs |
MU11KSUBA:M64640_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MG-U74AV2:103350_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOE430A:1451056_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOUSE430A_2:1451056_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOUSE430_2:1451056_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOE430A:1432820_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOUSE430A_2:1432820_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOUSE430_2:1432820_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOE430A:1454368_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOUSE430A_2:1454368_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
MOUSE430_2:1454368_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 |
mm |
RAE230A:1389245_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (predicted) |
rn |
RAT230_2:1389245_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (predicted) |
rn |
RAE230B:1379322_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (predicted) |
rn |
RAT230_2:1379322_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (predicted) |
rn |
RG-U34C:RC_AI070459_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (predicted) |
rn |
YEAST_2:1774707_AT |
Essential, non-ATPase regulatory subunit of the 26S proteasome; has similarity to the human p40 proteasomal subunit and to another S. cerevisiae regulatory subunit, Rpn11p |
Sc | |
|
|
|
|
|
blast |
NP_491319 |
proteasome Regulatory Particle, Non-ATPase-like family member (rpn-8) [Caenorhabditis elegans] gb|AAC17024.1| Proteasome regulatory particle, non-atpase-like protein 8 [Caenorhabditis elegans] |
0.0 |
blast |
CAE66740 |
Hypothetical protein CBG12090 [Caenorhabditis briggsae] |
1.0E-177 | |
|
|
|
|
|
Pfam |
IPR000555 EMBL-EBI |
Peptidase M67, Mov34 |
1.5E-46 | |
Sequence |
|
>C. ELEGANS:187980_AT
gaactccaccaatcaaaaccttcgagcatgtgccttcagatatcggagccgaagaagctg
aggaagttggagtcgagcatcttttgagagatatcaaggaccaaactgctggaactcttt
cacagcgtatcaccgatcaacttatgggcttgagaggactgcaatcacagcttgaatcca
ttgagaagtatcttcatgatattgtgcgcggaactcttccagtcaaccatcatgtcattt
actatgttcaagaagttctcaatctcctgcctgacgtcactcatccagactacattgttt
cacagaatgtgcaaactaatgatcagctcatgtgtgtgtatatgggatctcttgtacgat
cggtggtcgctttgcacaacttaattgataacaagatctctctccagaaggctga
BLASTn GenBank NR |
|
|
|
|
|
|
GAACTCCACCAATCAAAACCTTCGA |
24 |
345 |
554 |
Antisense |
AAAACCTTCGAGCATGTGCCTTCAG |
557 |
131 |
568 |
Antisense |
ATGTGCCTTCAGATATCGGAGCCGA |
285 |
49 |
581 |
Antisense |
ACCAAACTGCTGGAACTCTTTCACA |
246 |
85 |
653 |
Antisense |
TCTTTCACAGCGTATCACCGATCAA |
1 |
617 |
669 |
Antisense |
GGACTGCAATCACAGCTTGAATCCA |
473 |
523 |
709 |
Antisense |
TGATATTGTGCGCGGAACTCTTCCA |
394 |
563 |
750 |
Antisense |
TCAAGAAGTTCTCAATCTCCTGCCT |
7 |
633 |
801 |
Antisense |
TGACGTCACTCATCCAGACTACATT |
701 |
569 |
825 |
Antisense |
TTGTACGATCGGTGGTCGCTTTGCA |
161 |
693 |
905 |
Antisense |
ACAAGATCTCTCTCCAGAAGGCTGA |
587 |
113 |
944 |
Antisense | |
|
Affymetrix Proprietary Database | |