|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
187979_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.6478
|
|
Exemplar sequence
|
|
C30C11.2 NCBI
|
|
C30C11.2 /REP_DB=WormBase Gene ID /WP=CE00101 /GEN=rpn-3 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation /DEF=Diphenol oxidase A2
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_066468(11) |
|
|
|
|
|
NM_066468 NCBI |
Caenorhabditis elegans proteasome Regulatory Particle, Non-ATPase-like family member (rpn-3) (rpn-3) mRNA, complete cds. |
11/11 |
None |
SNAP00000009804 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:8447269:8448921:1 |
11/11 |
None |
GENEFINDER00000009808 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:8447269:8448921:1 |
11/11 |
None |
C30C11.2.2 ENSEMBL |
cdna:known chromosome:CEL140:III:8447263:8449079:1 gene:C30C11.2 |
11/11 |
None |
C30C11.2.1 ENSEMBL |
cdna:known chromosome:CEL140:III:8447265:8449224:1 gene:C30C11.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:8447264-8448917(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
Diphenol oxidase A2
|
|
rpn-3
|
|
C30C11.2
|
|
176196 Entrez gene
|
|
Q04908 EMBL-EBI
|
|
CE00101 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:261227_AT |
26S proteasome regulatory subunit S3, putative (RPN3) |
at |
CANINE:1606166_AT |
similar to 26S proteasome non-ATPase regulatory subunit 3 (26S proteasome regulatory subunit S3) (Proteasome subunit p58) |
cfa |
CANINE_2:CFA.21342.1.S1_S_AT |
similar to 26S proteasome non-ATPase regulatory subunit 3 (26S proteasome regulatory subunit S3) (Proteasome subunit p58) |
cfa |
CANINE_2:CFA.3239.1.S1_AT |
similar to 26S proteasome non-ATPase regulatory subunit 3 (26S proteasome regulatory subunit S3) (Proteasome subunit p58) |
cfa |
CANINE_2:CFAAFFX.24945.1.S1_AT |
similar to 26S proteasome non-ATPase regulatory subunit 3 (26S proteasome regulatory subunit S3) (Proteasome subunit p58) |
cfa |
CANINE_2:CFAAFFX.24945.1.S1_S_AT |
similar to 26S proteasome non-ATPase regulatory subunit 3 (26S proteasome regulatory subunit S3) (Proteasome subunit p58) |
cfa |
DROSOPHILA_2:1628269_AT |
Diphenol oxidase A2 |
dm |
DROSGENOME1:143129_AT |
Diphenol oxidase A2 |
dm |
CHICKEN:GGA.4645.3.S1_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
gga |
HG-U133_PLUS_2:201388_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HG-U133A_2:201388_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HG-U133A:201388_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HG-FOCUS:201388_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HU35KSUBA:RC_AA465243_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HU35KSUBA:R20358_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
U133_X3P:G4506228_3P_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HG-U95AV2:39155_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HG-U95D:83459_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HU35KSUBB:RC_T66906_F_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
HU35KSUBB:RC_T66906_R_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
hs |
MU11KSUBA:M25149_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
mm |
MU11KSUBB:MSA.439.0_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
mm |
MG-U74AV2:92769_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
mm |
MOE430A:1448479_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
mm |
MOUSE430A_2:1448479_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
mm |
MOUSE430_2:1448479_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 |
mm |
MG-U74AV2:161674_I_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 (Psmd3), mRNA |
mm |
RG-U34B:RC_AI007986_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 (predicted) |
rn |
RAE230A:1388466_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 (predicted) |
rn |
RAT230_2:1388466_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 (predicted) |
rn |
YEAST_2:1779691_AT |
Essential, non-ATPase regulatory subunit of the 26S proteasome lid, similar to the p58 subunit of the human 26S proteasome; temperature-sensitive alleles cause metaphase arrest, suggesting a role for the proteasome in cell cycle control |
Sc | |
|
|
|
|
|
blast |
AAA27966 |
Proteasome regulatory particle, non-atpase-like protein 3 [Caenorhabditis elegans] ref|NP_498869.1| proteasome Regulatory Particle, Non-ATPase-like family member (rpn-3) [Caenorhabditis elegans] sp|Q04908|PSD3_CAEEL 26S proteasome non-ATPase regulatory subunit 3 (26S proteasome regulatory subunit rpn-3) |
0.0 |
blast |
CAE71252 |
Hypothetical protein CBG18132 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR000717 EMBL-EBI |
Proteasome component region PCI |
2.1E-21 | |
Sequence |
|
>C. ELEGANS:187979_AT
tgggttgttgtcattggtcttctacaaggagagattcctgatcgaagtgtgttccgtcaa
ccaatttatcgcaaatgtcttgctcactacctggatctcagtcgaggcgttcgcgatgga
gatgttgctcgttttaatcataatttggagcaattcaaaacacagtttgaagctgatgat
actctcacattgattgttcgtctgcgtcaaaacgtcatcaagactgcaatcaagcaaatt
tctttggcgtattcccgaatttatatcaaggatattgccaagaagttgtatattactaac
gagacagagactgaatacattgtggcgaaggctattgccgatggagcaatcgatgctgtt
atcacttctgatgttcgtgatggacctcggtacatgcaaagttcagaaacagctgatatt
tatcgtacttcggagccacaagctcacttcgatactcgtatccgttactgcctcgaattg
cacaatcaagctgtcaaagctctcagatatccaccaa
BLASTn GenBank NR |
|
|
|
|
|
|
TGGGTTGTTGTCATTGGTCTTCTAC |
664 |
553 |
907 |
Antisense |
GTGTTCCGTCAACCAATTTATCGCA |
118 |
485 |
955 |
Antisense |
ATCGCAAATGTCTTGCTCACTACCT |
302 |
37 |
974 |
Antisense |
ACTACCTGGATCTCAGTCGAGGCGT |
598 |
101 |
992 |
Antisense |
GAGGCGTTCGCGATGGAGATGTTGC |
594 |
405 |
1010 |
Antisense |
CTCACATTGATTGTTCGTCTGCGTC |
637 |
227 |
1090 |
Antisense |
GCAATCGATGCTGTTATCACTTCTG |
55 |
323 |
1252 |
Antisense |
TGATGTTCGTGATGGACCTCGGTAC |
101 |
567 |
1275 |
Antisense |
GAGCCACAAGCTCACTTCGATACTC |
37 |
385 |
1339 |
Antisense |
TATCCGTTACTGCCTCGAATTGCAC |
518 |
657 |
1365 |
Antisense |
GTCAAAGCTCTCAGATATCCACCAA |
266 |
465 |
1399 |
Antisense | |
|
Affymetrix Proprietary Database | |