|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
187897_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.17058
|
|
Exemplar sequence
|
|
F59F5.6 NCBI
|
|
F59F5.6 /REP_DB=WormBase Gene ID /WP=CE03447 /GEN=syd-2 /TR=Q21049 /GB=CAA90660.1 /SUBMIT=HINXTON /CHR=X /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_077367(11) |
|
|
|
|
|
NM_077367 NCBI |
Caenorhabditis elegans F59F5.6 (liprin-alpha) mRNA, complete cds. |
11/11 |
A |
SNAP00000005594 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:10549816:10554862:-1 |
10/11 |
None |
GENEFINDER00000005597 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:10549816:10554862:-1 |
10/11 |
None |
F59F5.6 ENSEMBL |
cdna:known chromosome:CEL140:X:10549049:10554862:-1 gene:F59F5.6 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:10549435-10554862(-) |
98.77 |
100.0 |
| |
Public Domain and Genome References |
|
liprin-alpha
|
|
syd-2
|
|
F59F5.6
|
|
181255 Entrez gene
|
|
Q21049 EMBL-EBI
|
|
CE03447 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1603007_AT |
similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) |
cfa |
CANINE_2:CFAAFFX.16545.1.S1_S_AT |
similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) |
cfa |
CANINE_2:CFAAFFX.16630.1.S1_S_AT |
similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) |
cfa |
DROSOPHILA_2:1632099_S_AT |
|
dm |
DROSGENOME1:154634_AT |
|
dm |
CHICKEN:GGA.12241.1.S1_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
gga |
CHICKEN:GGA.12241.1.S1_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
gga |
CHICKEN:GGA.13097.1.S1_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
gga |
CHICKEN:GGAAFFX.26244.4.S1_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
gga |
HG-U95AV2:41782_G_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133_PLUS_2:210236_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133A:210236_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133A_2:210236_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95AV2:944_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HC-G110:944_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133_PLUS_2:210235_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133A:210235_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133A_2:210235_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HU35KSUBB:RC_H97922_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HUGENEFL:U22815_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HUGENEFL:U22816_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HUGENEFL:D49354_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
U133_X3P:G930340_3P_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
U133_X3P:G930340_3P_A_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
U133_X3P:HS.183648.0.S3_3P_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
U133_X3P:HS.183648.0.S1_3P_A_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133A_2:202065_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133_PLUS_2:202065_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133A:202065_S_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133A_2:202066_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-FOCUS:202066_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133_PLUS_2:202066_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133A:202066_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95AV2:41780_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95AV2:41781_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95B:44989_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95B:45470_G_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133_PLUS_2:242990_AT |
Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U133B:242990_AT |
Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95C:51638_AT |
Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95D:67092_AT |
Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95D:77349_AT |
Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
HG-U95D:89283_AT |
Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 |
hs |
MG-U74BV2:110020_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 |
mm |
MG-U74BV2:106650_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 |
mm |
MOE430B:1455478_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 |
mm |
MOUSE430_2:1455478_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 |
mm |
MOE430B:1435861_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 |
mm |
MOUSE430_2:1435861_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 |
mm |
MU19KSUBA:TC17068_AT |
PREDICTED: similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) [Mus musculus], mRNA sequence |
mm |
MU19KSUBB:TC31494_AT |
PREDICTED: similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) [Mus musculus], mRNA sequence |
mm |
MU19KSUBC:TC38950_AT |
PREDICTED: similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) [Mus musculus], mRNA sequence |
mm |
MU19KSUBC:TC41568_AT |
PREDICTED: similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) [Mus musculus], mRNA sequence |
mm |
MU19KSUBC:TC41568_G_AT |
PREDICTED: similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) [Mus musculus], mRNA sequence |
mm |
RAE230B:1384832_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 (predicted) |
rn |
RAT230_2:1384832_AT |
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 (predicted) |
rn | |
|
|
|
|
|
7274 |
neuromuscular synaptic transmission |
inferred from direct assay |
QuickGO AmiGO |
43113 |
receptor clustering |
inferred from sequence similarity |
QuickGO AmiGO |
|
|
|
|
30424 |
axon |
inferred from direct assay |
QuickGO AmiGO |
45202 |
synapse |
inferred from direct assay |
QuickGO AmiGO |
5737 |
cytoplasm |
inferred from direct assay |
QuickGO AmiGO |
|
|
|
|
19903 |
protein phosphatase binding |
inferred from physical interaction |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA90660 |
Hypothetical protein F59F5.6 [Caenorhabditis elegans] ref|NP_509768.1| F59F5.6 [Caenorhabditis elegans] gb|AAD47840.1| liprin-alpha homolog SYD-2 [Caenorhabditis elegans] sp|Q21049|LIPA_CAEEL Liprin alpha (LAR-interacting protein alpha) (Synapse defective protein 2) |
0.0 |
blast |
CAE60801 |
Hypothetical protein CBG04493 [Caenorhabditis briggsae] |
0.0 |
blast |
XP_238162 |
PREDICTED: similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) [Rattus norvegicus] |
0.0 |
blast |
XP_133979 |
PREDICTED: similar to Liprin-alpha 1 (Protein tyrosine phosphatase receptor type f polypeptide-interacting protein alpha 1) (PTPRF-interacting protein alpha 1) (LAR-interacting protein 1) (LIP.1) [Mus musculus] |
0.0 | |
|
|
|
|
|
Pfam |
IPR001660 EMBL-EBI |
Sterile alpha motif SAM |
4.3E-8 |
Pfam |
IPR001660 EMBL-EBI |
Sterile alpha motif SAM |
4.3E-8 | |
Sequence |
|
>C. ELEGANS:187897_S_AT
tctgactcttgccttcggagatatgaatcatgaatatattggaaacgactggcttccttg
tctcggtcttgcgcaataccgatcagcgtttatggaatgtcttcttgacgctcgaatgtt
agaacatctttcaaaacgtgacctacgcacgcatctgcgcatggtagacacattccatcg
tacaagtctccaatacggaattatgtgtctcaagaaagtcaactatgataagaaagtgtt
ggcggatcggcgaaaggcgtgtgataatatcaacacagacttgctagtgtggtcgaatga
acgagttcagcgatgggtggaagaaatcgggctaggtgtattttcaagaaatttagtgga
tagtggaatacatggtgcattaattgcactggatgaaacgtttgacgcatccgcttttgc
atatgcactccagattggatctcaagacgttcctaacagacaactactggaaaagaaatt
cattggcttagtcaacgatcaccgtcaacaatccgatccccatccgagaagtggaa
BLASTn GenBank NR |
|
|
|
|
|
|
TCTGACTCTTGCCTTCGGAGATATG |
62 |
609 |
2841 |
Antisense |
TTGGAAACGACTGGCTTCCTTGTCT |
285 |
709 |
2879 |
Antisense |
GGTCTTGCGCAATACCGATCAGCGT |
453 |
503 |
2905 |
Antisense |
TGGAATGTCTTCTTGACGCTCGAAT |
690 |
545 |
2933 |
Antisense |
CTACGCACGCATCTGCGCATGGTAG |
13 |
227 |
2983 |
Antisense |
GACACATTCCATCGTACAAGTCTCC |
394 |
367 |
3007 |
Antisense |
TGAAACGTTTGACGCATCCGCTTTT |
408 |
573 |
3234 |
Antisense |
TCCGCTTTTGCATATGCACTCCAGA |
492 |
595 |
3250 |
Antisense |
GGATCTCAAGACGTTCCTAACAGAC |
468 |
511 |
3277 |
Antisense |
GGCTTAGTCAACGATCACCGTCAAC |
494 |
535 |
3325 |
Antisense |
TCCGATCCCCATCCGAGAAGTGGAA |
100 |
595 |
3352 |
Antisense | |
|
Affymetrix Proprietary Database | |