|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
187868_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.6611
|
|
Exemplar sequence
|
|
C06E1.4 NCBI
|
|
C06E1.4 /REP_DB=WormBase Gene ID /WP=CE00059 /GEN=glr-1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation /DEF=Glutamate receptor
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_066486(11) |
|
|
|
|
|
NM_066486 NCBI |
Caenorhabditis elegans GLutamate Receptor family (AMPA) family member (glr-1) (glr-1) mRNA, complete cds. |
11/11 |
A |
SNAP00000034816 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:8584159:8588518:-1 |
11/11 |
None |
GENEFINDER00000034832 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:8584159:8588518:-1 |
11/11 |
None |
C06E1.4 ENSEMBL |
cdna:known chromosome:CEL140:III:8584058:8588602:-1 gene:C06E1.4 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:8584153-8588948(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
Glutamate receptor subunit
|
|
glr-1
|
|
C06E1.4
|
|
176204 Entrez gene
|
|
P34299 EMBL-EBI
|
|
CE31407 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFAAFFX.27226.1.S1_S_AT |
similar to Glutamate receptor 1 precursor (GluR-1) (GluR-A) (GluR-K1) (Glutamate receptor ionotropic, AMPA 1) |
cfa |
CANINE_2:CFAAFFX.27257.1.S1_S_AT |
similar to Glutamate receptor 1 precursor (GluR-1) (GluR-A) (GluR-K1) (Glutamate receptor ionotropic, AMPA 1) |
cfa |
CHICKEN:GGA.942.1.S1_AT |
similar to AMPA receptor GluR1/A |
gga |
CHICKEN:GGA.942.1.S1_S_AT |
similar to AMPA receptor GluR1/A |
gga |
CHICKEN:GGA.943.1.S1_S_AT |
similar to AMPA receptor GluR1/A |
gga |
HG-U133_PLUS_2:209793_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U133A_2:209793_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-FOCUS:209793_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U133A:209793_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U133_PLUS_2:211520_S_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U133A:211520_S_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U133A_2:211520_S_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U95AV2:36854_S_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HU35KSUBA:M81886_S_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HUGENEFL:M81886_S_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HUGENEFL:M64752_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
U133_X3P:G183280_3P_A_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
U133_X3P:HS.7117.1.A2_3P_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U95AV2:36853_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U95AV2:36855_R_AT |
glutamate receptor, ionotropic, AMPA 1 |
hs |
U133_X3P:HS.302185.0.S1_3P_AT |
Glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U133A_2:215634_AT |
Glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U133_PLUS_2:215634_AT |
Glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U133A:215634_AT |
Glutamate receptor, ionotropic, AMPA 1 |
hs |
HG-U95AV2:32273_AT |
Glutamate receptor, ionotropic, AMPA 1 |
hs |
HU35KSUBC:RC_Z41488_AT |
Glutamate receptor, ionotropic, AMPA 1 |
hs |
HU35KSUBB:RC_T23452_S_AT |
Glutamate receptor, ionotropic, AMPA 1 |
hs |
HUGENEFL:Z70220_AT |
Glutamate receptor, ionotropic, AMPA 1 |
hs |
MU11KSUBB:X57497_S_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MG-U74AV2:92943_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MG-U74AV2:92944_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MG-U74BV2:117291_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MG-U74CV2:165781_R_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MOE430A:1435239_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MOUSE430A_2:1435239_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MOUSE430_2:1435239_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MOE430A:1448972_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MOUSE430A_2:1448972_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MOUSE430_2:1448972_AT |
glutamate receptor, ionotropic, AMPA1 (alpha 1) |
mm |
MOUSE430_2:1458285_AT |
Glutamate receptor, ionotropic, AMPA1 (alpha 1) (Gria1), mRNA |
mm |
MOE430B:1458285_AT |
Glutamate receptor, ionotropic, AMPA1 (alpha 1) (Gria1), mRNA |
mm | |
|
|
|
|
|
6810 |
transport |
inferred from electronic annotation |
QuickGO AmiGO |
6811 |
ion transport |
inferred from electronic annotation |
QuickGO AmiGO |
35235 |
ionotropic glutamate receptor signaling pathway |
inferred from sequence similarity |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
30288 |
periplasmic space (sensu Gram-negative Bacteria) |
inferred from electronic annotation |
QuickGO AmiGO |
45211 |
postsynaptic membrane |
inferred from direct assay |
QuickGO AmiGO |
43025 |
cell soma |
inferred from direct assay |
QuickGO AmiGO |
43005 |
neuron projection |
inferred from direct assay |
QuickGO AmiGO |
8328 |
ionotropic glutamate receptor complex |
inferred from sequence similarity |
QuickGO AmiGO |
|
|
|
|
4872 |
receptor activity |
inferred from electronic annotation |
QuickGO AmiGO |
4970 |
ionotropic glutamate receptor activity |
inferred from electronic annotation |
QuickGO AmiGO |
5215 |
transporter activity |
inferred from electronic annotation |
QuickGO AmiGO |
5216 |
ion channel activity |
inferred from electronic annotation |
QuickGO AmiGO |
5234 |
glutamate-gated ion channel activity |
inferred from electronic annotation |
QuickGO AmiGO |
4971 |
alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity |
inferred from sequence similarity |
QuickGO AmiGO |
16595 |
glutamate binding |
inferred from sequence similarity |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAA27933 |
Glutamate receptor family (ampa) protein 1 [Caenorhabditis elegans] ref|NP_498887.2| GLutamate Receptor family (AMPA) family member (glr-1) [Caenorhabditis elegans] sp|P34299|GLR1_CAEEL Glutamate receptor 1 precursor pir||S60225 ionotropic glutamate receptor - Caenorhabditis elegans gb|AAA92006.1| ionotropic glutamate receptor subunit prf||2123408A Glu receptor GLR-1 |
0.0 |
blast |
CAE71239 |
Hypothetical protein CBG18112 [Caenorhabditis briggsae] |
0.0 |
blast |
AAO61447 |
Glutamate receptor family (ampa) protein 2, isoform b [Caenorhabditis elegans] ref|NP_001021114.1| GLutamate Receptor family (AMPA) family member (glr-2) [Caenorhabditis elegans] gb|AAK01094.2| non-NMDA ionotropic glutamate receptor subunit GLR-2 [Caenorhabditis elegans] sp|Q10914|GLR2_CAEEL Glutamate receptor 2 precursor |
0.0 | |
|
|
|
|
|
Pfam |
IPR001320 EMBL-EBI |
Ionotropic glutamate receptor |
1.0E-126 |
Pfam |
IPR001320 EMBL-EBI |
Ionotropic glutamate receptor |
1.0E-126 |
NP_498887.2 |
4 |
594-616,636-654,669-691,858-880 |
C06E1.4 |
4 |
594-616,636-654,669-691,858-880 |
SNAP00000034816 |
4 |
595-617,637-655,670-692,859-881 |
GENEFINDER00000034832 |
4 |
594-616,636-654,669-691,858-880 | |
Sequence |
|
>C. ELEGANS:187868_S_AT
atggaatagcgacacctttcggctccgactggaaggatcatatcaacttggcaattttag
ccctccaagaacgtggtgaactgaaaaagttggaaaacaaatggtggtatgatagaggac
aatgcgatgcgggtattactgttgacgggtcatctgctagtttgaatctatcaaaagttg
ctggaatattttatattttaatgggtggtatggtcatttcaatgttggctgcactcgggg
aattcttgtatcgaagtaggattgaagcgaggaaatctaattccaattctatggtggcga
attttgcgaaaaatttgaaaagtgcattgtcatctcaattaagattatcagtcgaaggag
gtgcagttgcacaaccaggatctcaatctcataatgcaattagaagacaacaggtagctg
cattcttgcctgca
BLASTn GenBank NR |
|
|
|
|
|
|
ATGGAATAGCGACACCTTTCGGCTC |
358 |
53 |
2465 |
Antisense |
CGGCTCCGACTGGAAGGATCATATC |
141 |
243 |
2484 |
Antisense |
GCAATTTTAGCCCTCCAAGAACGTG |
185 |
323 |
2515 |
Antisense |
GAGGACAATGCGATGCGGGTATTAC |
53 |
405 |
2579 |
Antisense |
GCGGGTATTACTGTTGACGGGTCAT |
322 |
237 |
2593 |
Antisense |
GACGGGTCATCTGCTAGTTTGAATC |
258 |
375 |
2608 |
Antisense |
GGTCATTTCAATGTTGGCTGCACTC |
590 |
503 |
2676 |
Antisense |
GCTGCACTCGGGGAATTCTTGTATC |
404 |
297 |
2692 |
Antisense |
TCAGTCGAAGGAGGTGCAGTTGCAC |
304 |
623 |
2812 |
Antisense |
GCAGTTGCACAACCAGGATCTCAAT |
23 |
313 |
2827 |
Antisense |
ACAGGTAGCTGCATTCTTGCCTGCA |
237 |
107 |
2874 |
Antisense | |
|
Affymetrix Proprietary Database | |