|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
187561_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.9024
|
|
Exemplar sequence
|
|
C17H12.14 NCBI
|
|
C17H12.14 /REP_DB=WormBase Gene ID /WP=CE19362 /GB=AAK67210.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=ATPase
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_068639(11) |
|
|
|
|
|
NM_068639 NCBI |
Caenorhabditis elegans C17H12.14 (ATPase) mRNA, complete cds. |
11/11 |
None |
SNAP00000015106 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:6791082:6792010:1 |
11/11 |
None |
GENEFINDER00000015121 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:6791082:6792122:1 |
11/11 |
None |
C17H12.14.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:6791056:6792548:1 gene:C17H12.14 |
11/11 |
None |
C17H12.14.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:6791058:6792548:1 gene:C17H12.14 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:6791087-6792016(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ATPase
|
|
vha-8
|
|
C17H12.14
|
|
177442 Entrez gene
|
|
Q95X44 EMBL-EBI
|
|
CE19362 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:262354_AT |
vacuolar ATP synthase subunit E, putative / V-ATPase E subunit, putative / vacuolar proton pump E subunit, putative |
at |
CANINE:1601154_AT |
similar to ATPase, H+ transporting, V1 subunit E isoform 1 |
cfa |
CANINE:1599371_AT |
similar to ATPase, H+ transporting, V1 subunit E isoform 1 |
cfa |
CANINE:1589967_S_AT |
similar to ATPase, H+ transporting, V1 subunit E isoform 1 |
cfa |
CANINE_2:CFA.1302.1.S1_AT |
similar to ATPase, H+ transporting, V1 subunit E isoform 1 |
cfa |
CANINE_2:CFAAFFX.24784.1.S1_S_AT |
similar to ATPase, H+ transporting, V1 subunit E isoform 1 |
cfa |
DROSOPHILA_2:1629065_S_AT |
Vacuolar H+-ATPase 26kD E subunit |
dm |
DROSGENOME1:151930_AT |
Vacuolar H+-ATPase 26kD E subunit |
dm |
CHICKEN:GGAAFFX.12188.1.S1_S_AT |
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 |
gga |
HG-U133_PLUS_2:208678_AT |
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 |
hs |
HG-U133A_2:208678_AT |
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 |
hs |
HG-U133A:208678_AT |
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 |
hs |
HG-FOCUS:208678_AT |
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 |
hs |
HUGENEFL:X76228_AT |
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 |
hs |
U133_X3P:G13325247_3P_AT |
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 |
hs |
HG-U95AV2:37367_AT |
ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1 |
hs |
MOUSE430_2:1449711_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MOE430A:1449711_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MOUSE430A_2:1449711_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MOUSE430_2:1449712_S_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MOE430A:1449712_S_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MOUSE430A_2:1449712_S_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MU11KSUBA:U13841_F_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MU11KSUBB:MSA.23749.0_F_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MU11KSUBB:MSA.1869.0_F_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MU11KSUBB:MSA.11239.0_F_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MU11KSUBB:MSA.11002.0_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MG-U74AV2:94532_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MOE430B:1457049_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MOUSE430_2:1457049_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
mm |
MOUSE430_2:1420038_AT |
V-ATPase E2 subunit |
mm |
MOE430A:1420038_AT |
V-ATPase E2 subunit |
mm |
MOUSE430A_2:1420038_AT |
V-ATPase E2 subunit |
mm |
MU19KSUBB:TC26272_AT |
V-ATPase E2 subunit |
mm |
RG-U34C:RC_AI169159_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
rn |
RAE230A:1371564_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
rn |
RAT230_2:1371564_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
rn |
RAE230A:1377229_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
rn |
RAT230_2:1377229_AT |
ATPase, H+ transporting, V1 subunit E isoform 1 |
rn |
YEAST_2:1772572_AT |
Subunit E of the eight-subunit V1 peripheral membrane domain of the vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found throughout the endomembrane system; required for the V1 domain to assemble onto the vacuolar membrane |
Sc | |
|
|
|
|
|
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAK67210 |
Vacuolar h atpase protein 8 [Caenorhabditis elegans] ref|NP_501040.1| C17H12.14 [Caenorhabditis elegans] |
1.0E-111 |
blast |
CAE61478 |
Hypothetical protein CBG05372 [Caenorhabditis briggsae] |
1.0E-107 |
blast |
AAK67210 |
Vacuolar h atpase protein 8 [Caenorhabditis elegans] ref|NP_501040.1| C17H12.14 [Caenorhabditis elegans] |
3.0E-99 |
blast |
CAE61478 |
Hypothetical protein CBG05372 [Caenorhabditis briggsae] |
3.0E-95 | |
|
|
|
|
|
Pfam |
IPR002842 EMBL-EBI |
H+-transporting two-sector ATPase, E subunit |
6.4E-80 |
Pfam |
IPR002842 EMBL-EBI |
H+-transporting two-sector ATPase, E subunit |
2.5E-71 | |
Sequence |
|
>C. ELEGANS:187561_S_AT
acgcaaaattcaagcctccaactctctcaacgctggacgtcttcgttgcttgaaggctcg
tgaagaccacatcggagccgtactcgacgaggctcgctcgaatctctcccgtatttccgg
agatgctgctcgttatccagctattttgaagggacttgtcatgcaaggacttcttcaatt
gctcgaaaaggaagtcgtccttcgttgccgtgagaaggatcttcgtcttgttgagcaact
tttgccagagtgccttgacggacttcaaaaggagtggggaagcaccaccaaggtcgttct
cgataaacaaaacttcttgccatcggagtctgctggaggagttgaactttctgctcgtgc
tggaaagatcaaggtgtcgtctactcttgaaagccgtttagagcttattgctaaccagat
tgtcccacaagtcagaacagctctcttcggt
BLASTn GenBank NR |
|
|
|
|
|
|
ACGCAAAATTCAAGCCTCCAACTCT |
171 |
91 |
213 |
Antisense |
GGACGTCTTCGTTGCTTGAAGGCTC |
222 |
523 |
247 |
Antisense |
GTACTCGACGAGGCTCGCTCGAATC |
463 |
459 |
292 |
Antisense |
GAATCTCTCCCGTATTTCCGGAGAT |
156 |
329 |
312 |
Antisense |
TCCGGAGATGCTGCTCGTTATCCAG |
228 |
595 |
328 |
Antisense |
GGATCTTCGTCTTGTTGAGCAACTT |
123 |
513 |
429 |
Antisense |
GCAACTTTTGCCAGAGTGCCTTGAC |
700 |
319 |
447 |
Antisense |
TTCTTGCCATCGGAGTCTGCTGGAG |
505 |
689 |
526 |
Antisense |
AGGAGTTGAACTTTCTGCTCGTGCT |
206 |
57 |
549 |
Antisense |
AAGGTGTCGTCTACTCTTGAAAGCC |
570 |
159 |
583 |
Antisense |
ACAAGTCAGAACAGCTCTCTTCGGT |
96 |
113 |
639 |
Antisense | |
|
Affymetrix Proprietary Database | |