|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
187354_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.5152
|
|
Exemplar sequence
|
|
C44B7.1 NCBI
|
|
C44B7.1 /REP_DB=WormBase Gene ID /WP=CE25810 /TR=SW:Q10920 /GB=AAC46754.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063012(11) |
|
|
|
|
|
NM_063012 NCBI |
Caenorhabditis elegans C44B7.1 (C44B7.1) mRNA, complete cds. |
11/11 |
None |
SNAP00000013952 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:6902024:6902771:1 |
11/11 |
None |
GENEFINDER00000013965 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:6902024:6902771:1 |
11/11 |
None |
C44B7.1.2 ENSEMBL |
cdna:known chromosome:CEL140:II:6901259:6902862:1 gene:C44B7.1 |
11/11 |
None |
C44B7.1.3 ENSEMBL |
cdna:known chromosome:CEL140:II:6901259:6902771:1 gene:C44B7.1 |
11/11 |
None |
C44B7.1.1 ENSEMBL |
cdna:known chromosome:CEL140:II:6901440:6902862:1 gene:C44B7.1 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:6902019-6902767(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
C44B7.1
|
|
174129 Entrez gene
|
|
Q10920 EMBL-EBI
|
|
CE25810 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1602888_AT |
similar to 26S proteasome non-ATPase regulatory subunit 9 (26S proteasome regulatory subunit p27) |
cfa |
CANINE:1585328_AT |
similar to 26S proteasome non-ATPase regulatory subunit 9 (26S proteasome regulatory subunit p27) |
cfa |
CANINE_2:CFA.7881.1.A1_AT |
similar to 26S proteasome non-ATPase regulatory subunit 9 (26S proteasome regulatory subunit p27) |
cfa |
CANINE_2:CFA.8121.1.A1_S_AT |
similar to 26S proteasome non-ATPase regulatory subunit 9 (26S proteasome regulatory subunit p27) |
cfa |
CANINE_2:CFAAFFX.12851.1.S1_AT |
similar to 26S proteasome non-ATPase regulatory subunit 9 (26S proteasome regulatory subunit p27) |
cfa |
DROSOPHILA_2:1629777_AT |
|
dm |
DROSGENOME1:149853_AT |
|
dm |
CHICKEN:GGAAFFX.12466.1.S1_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
gga |
HG-U95AV2:1444_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HC-G110:1444_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-U133_PLUS_2:207805_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-U133A:207805_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-FOCUS:207805_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-U133A_2:207805_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-U133_PLUS_2:209334_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-U133A:209334_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-U133A_2:209334_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HUGENEFL:AB003177_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
U133_X3P:G4506234_3P_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
U133_X3P:G12803158_3P_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-U95AV2:36492_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
HG-U95C:66953_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
hs |
MOUSE430_2:1447670_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MOE430B:1447670_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MG-U74AV2:97929_R_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MU11KSUBB:W77431_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MOE430A:1423387_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MOUSE430A_2:1423387_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MOUSE430_2:1423387_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MOE430A:1423386_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MOUSE430A_2:1423386_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MOUSE430_2:1423386_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
mm |
MG-U74BV2:116095_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 (Psmd9), mRNA |
mm |
MOUSE430_2:1444321_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 (Psmd9), mRNA |
mm |
MOE430B:1444321_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 (Psmd9), mRNA |
mm |
MU19KSUBA:TC23836_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 (Psmd9), mRNA |
mm |
RG-U34C:RC_AI175576_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
rn |
RAE230A:1368184_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
rn |
RAT230_2:1368184_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |
rn |
YEAST_2:1777842_AT |
Protein with similarity to the p27 subunit of mammalian proteasome modulator; not essential; interacts with Rpn4p |
Sc | |
|
|
|
|
|
5515 |
protein binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAL16319 |
Hypothetical protein C44B7.1 [Caenorhabditis elegans] ref|NP_495413.1| C44B7.1 [Caenorhabditis elegans] sp|Q10920|PSD9_CAEEL Probable 26S proteasome non-ATPase regulatory subunit |
1.0E-109 |
blast |
CAE65990 |
Hypothetical protein CBG11181 [Caenorhabditis briggsae] |
6.0E-92 | |
Sequence |
|
>C. ELEGANS:187354_AT
acttcttcaacaacgcgacgaactcgatggaaaaattaaagaacttatgctagttctgga
gacgaataacagcactatggattcgccacttcttgatgcagaaggatatcccctgaatac
aattgatgtctatgctgttcgtcatgctaggcatgatctgatttgtctcagaaatgatcg
agcagcgttaacggagaaaattgttgttgaaatggaaaacgagaataaagaagtttcggg
acaaactgccacatccgaggaaaagccagttcacagaacttcgaatgaaccatttgtcaa
aatttcatctgtcgttgagttatcgcctgcggatattggaggtttcagaaaagacgattt
gattattcaatatggaaatcttcatcatggaaactttaacgatatgcaagaagttgcaca
gataactaagcaaagtgaagacaagatcattcgggtaactgtcattcgcgagaaccgccc
agttcgtcttgaaatttgcccaaaaaagtggtcgggtccaggacttcttggatgc
BLASTn GenBank NR |
|
|
|
|
|
|
ACTTCTTCAACAACGCGACGAACTC |
311 |
103 |
39 |
Antisense |
ACAGCACTATGGATTCGCCACTTCT |
361 |
107 |
107 |
Antisense |
GGATTCGCCACTTCTTGATGCAGAA |
350 |
509 |
117 |
Antisense |
GTCTATGCTGTTCGTCATGCTAGGC |
447 |
467 |
166 |
Antisense |
GCTAGGCATGATCTGATTTGTCTCA |
394 |
303 |
184 |
Antisense |
GACAAACTGCCACATCCGAGGAAAA |
35 |
367 |
278 |
Antisense |
ATCTGTCGTTGAGTTATCGCCTGCG |
142 |
35 |
345 |
Antisense |
GATCATTCGGGTAACTGTCATTCGC |
437 |
417 |
483 |
Antisense |
TAACTGTCATTCGCGAGAACCGCCC |
442 |
637 |
494 |
Antisense |
GCCCAGTTCGTCTTGAAATTTGCCC |
256 |
285 |
515 |
Antisense |
GTCGGGTCCAGGACTTCTTGGATGC |
248 |
473 |
549 |
Antisense | |
|
Affymetrix Proprietary Database | |