[Home] | [Total List]

[187328_s_at]

Description F37A4.8 /REP_DB=WormBase Gene ID /WP=CE00789 /TR=SW:P41877 /GB=AAA50636.1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
Cluster 6grp_highest_10_10 > 86      6grp_high1_10_10 > 67      4grp_highest_8_8 > 41      4grp_high_8_8 > 49      6grp_highest_nonorm > 88      6grp_total > 68      4grp_total > 62      6grp_highest_sub > Da      6grp_cgc > 38      6grp_high1_sub > Da      6grp_cgc_sub > Da      6grp_total_sub > Increase      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 692
1 2 3 4 range
A 1267.6
(3)
P 		835.6
(-0.8)
P 		926.1
(-0)
P 		593.9
(-3)
P 		674
B 1219.8
(3)
P 		970
(0.2)
P 		1030.3
(0.9)
P 		682.7
(-3)
P 		537
C 1285.4
(3)
P 		830.8
(-1.4)
P 		981.9
(0)
P 		672.2
(-3)
P 		613
avr 1257.6
(3) 		878.8
(-0.7) 		979.4
(0.3) 		649.6
(-3) 		608

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1012
1 2 3 4 5 6 range
A 1279.7
(-0.7)
P 		1126.6
(-1.7)
P 		918
(-3)
P 		912.4
(-3)
P 		1263.2
(-0.8)
P 		1867.6
(3)
P 		955
B 1216.3
(-1.2)
P 		1044.5
(-2.8)
P 		1024.3
(-3)
P 		1232.1
(-1.1)
P 		1085.9
(-2.4)
P 		1666.4
(3)
P 		642
C 1123.4
(-2.1)
P 		1162.4
(-1.8)
P 		979.8
(-3)
P 		1180.7
(-1.7)
P 		1095
(-2.3)
P 		1924.7
(3)
P 		945
avr 1206.5
(-1.4) 		1111.2
(-2) 		974
(-3) 		1108.4
(-2) 		1148
(-1.8) 		1819.6
(3) 		846
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 375
1 2 3 4 range
A 461.5
(3)
P 		181.4
(-1.5)
P 		242.1
(-0.5)
P 		86.9
(-3)
P 		375
B 389
(3)
P 		239.6
(-0.7)
P 		238.8
(-0.7)
P 		145.5
(-3)
P 		244
C 425.5
(3)
P 		238.9
(-0.6)
P 		342.2
(1.4)
P 		113.3
(-3)
P 		312
avr 425.3
(3) 		220
(-1) 		274.4
(0.1) 		115.2
(-3) 		310

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 444
1 2 3 4 5 6 range
A 235.9
(-2.2)
P 		400.7
(1.7)
P 		199.9
(-3)
P 		231.4
(-2.3)
P 		381.2
(1.3)
P 		454.7
(3)
P 		255
B 423.2
(-0.2)
P 		347.7
(-1.4)
P 		248.7
(-3)
P 		326.3
(-1.8)
P 		441.2
(0.1)
P 		621.4
(3)
P 		373
C 416.4
(-0.4)
P 		354.7
(-1.3)
P 		249.4
(-2.8)
P 		237.4
(-3)
P 		354.3
(-1.3)
P 		644.3
(3)
P 		407
avr 358.5
(-0.8) 		367.7
(-0.6) 		232.7
(-3) 		265
(-2.4) 		392.2
(-0.2) 		573.5
(3) 		341
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 187328_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.6840
Sequence Type Exemplar sequence
Representative Public ID F37A4.8 NCBI
Target Description F37A4.8 /REP_DB=WormBase Gene ID /WP=CE00789 /TR=SW:P41877 /GB=AAA50636.1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_066067(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_066067 NCBI Caenorhabditis elegans yeast ISW (imitation SWI) homolog family member (isw-1) (isw-1) mRNA, complete cds. 11/11 None
SNAP00000044167 ENSEMBL cdna:SNAP chromosome:CEL140:III:6704151:6709935:-1 11/11 None
GENEFINDER00000044182 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:6704151:6705017:-1 11/11 None
F37A4.8 ENSEMBL cdna:known chromosome:CEL140:III:6703947:6709990:-1 gene:F37A4.8 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:6704149-6709749(-) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol isw-1
Ensembl F37A4.8
Entrez Gene 175944 Entrez gene
SwissProt P41877 EMBL-EBI
WormBase CE29792 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:13902_AT DNA-dependent ATPase, putative at
ATH1-121501:249997_AT DNA-dependent ATPase, putative at
CANINE:1604028_AT similar to SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 5 (SWI/SNF-related matrix-associated actin-dependent regulator of chromatin A5) (Sucrose nonfermenting protein 2 homolog) (hSNF2H)... cfa
CANINE:1603241_AT similar to SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 5 (SWI/SNF-related matrix-associated actin-dependent regulator of chromatin A5) (Sucrose nonfermenting protein 2 homolog) (hSNF2H)... cfa
CANINE:1599411_AT similar to SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 5 (SWI/SNF-related matrix-associated actin-dependent regulator of chromatin A5) (Sucrose nonfermenting protein 2 homolog) (hSNF2H)... cfa
CANINE_2:CFA.20881.1.S1_S_AT similar to SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 5 (SWI/SNF-related matrix-associated actin-dependent regulator of chromatin A5) (Sucrose nonfermenting protein 2 homolog) (hSNF2H)... cfa
CANINE_2:CFA.936.1.S1_AT similar to SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 5 (SWI/SNF-related matrix-associated actin-dependent regulator of chromatin A5) (Sucrose nonfermenting protein 2 homolog) (hSNF2H)... cfa
CANINE_2:CFAAFFX.12160.1.S1_S_AT similar to SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 5 (SWI/SNF-related matrix-associated actin-dependent regulator of chromatin A5) (Sucrose nonfermenting protein 2 homolog) (hSNF2H)... cfa
DROSGENOME1:143667_AT Imitation SWI dm
DROSOPHILA_2:1641309_S_AT Imitation SWI dm
CHICKEN:GGAAFFX.11920.1.S1_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 gga
HG-U133_PLUS_2:202303_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
HG-U133A_2:202303_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
HG-U133A:202303_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
HU35KSUBC:RC_AA598468_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
U133_X3P:G4507074_3P_A_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
U133_X3P:HS.9456.1.A1_3P_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
U133_X3P:HS.9456.1.A1_3P_A_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
HG-U133A_2:213859_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
HG-U133_PLUS_2:213859_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
HG-U133A:213859_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
HG-U95C:63189_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
HU35KSUBB:RC_R49510_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 hs
MU11KSUBB:MSA.34219.0_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MU11KSUBB:MSA.27327.0_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MG-U74AV2:93701_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MG-U74AV2:97394_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MG-U74BV2:163926_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOE430A:1424206_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOUSE430A_2:1424206_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOUSE430_2:1424206_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOE430A:1424207_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOUSE430A_2:1424207_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOUSE430_2:1424207_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOE430A:1424205_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOUSE430A_2:1424205_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MOUSE430_2:1424205_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 mm
MU19KSUBB:TC31076_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5, mRNA (cDNA clone IMAGE:4488056) mm
RG-U34B:RC_AA801246_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (predicted) rn
RAE230B:1379327_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (predicted) rn
RAT230_2:1379327_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (predicted) rn
RAE230B:1384246_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (predicted) rn
RAT230_2:1384246_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (predicted) rn
RAE230B:1394093_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (predicted) rn
RAT230_2:1394093_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (predicted) rn
RG-U34B:RC_AI070316_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 (predicted) rn
YEAST_2:1772675_AT Member of the imitation-switch (ISWI) class of ATP-dependent chromatin remodeling complexes; ATPase that forms a complex with Ioc2p and Ioc4p to regulate transcription elongation, and a complex with Ioc3p to repress transcription initiation Sc
Gene Ontology
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3676 nucleic acid binding inferred from electronic annotation QuickGO AmiGO
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
4386 helicase activity inferred from electronic annotation QuickGO AmiGO
5524 ATP binding inferred from electronic annotation QuickGO AmiGO
8026 ATP-dependent helicase activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA50636 Yeast isw (imitation swi) homolog protein 1 [Caenorhabditis elegans] ref|NP_498468.2| yeast ISW (imitation SWI) homolog family member (isw-1) [Caenorhabditis elegans] sp|P41877|ISW1_CAEEL Chromatin remodelling complex ATPase chain isw-1 0.0
blast S44645 hypothetical protein F37A4.8 - Caenorhabditis elegans 0.0
blast CAE70121 Hypothetical protein CBG16574 [Caenorhabditis briggsae] 0.0
blast AAA50636 Yeast isw (imitation swi) homolog protein 1 [Caenorhabditis elegans] ref|NP_498468.2| yeast ISW (imitation SWI) homolog family member (isw-1) [Caenorhabditis elegans] sp|P41877|ISW1_CAEEL Chromatin remodelling complex ATPase chain isw-1 1.0E-126
Protein Domains
Database ID Description E-Value
scop a.4.1.Myb All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Myb 9.0
scop a.4.1.Myb All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Myb 9.60000038146973
Pfam IPR000330 EMBL-EBI SNF2 related domain 1.0E-126
Pfam IPR001005 EMBL-EBI Myb DNA-binding domain 0.0039
Pfam IPR001650 EMBL-EBI Helicase, C-terminal 1.3E-27
Pfam IPR000330 EMBL-EBI SNF2 related domain 1.0E-126
Pfam IPR001005 EMBL-EBI Myb DNA-binding domain 0.0039
Pfam IPR001650 EMBL-EBI Helicase, C-terminal 1.3E-27
Pfam IPR001005 EMBL-EBI Myb DNA-binding domain 0.0039
Sequence
Target Sequence 
>C. ELEGANS:187328_S_AT
aacgcgagttccaacagtttgttagaggaaatgaaaagtatggtcgtgaagatttggaga
gtatcgcgaaggaaatggaacgtccacttgaagagattcaatcttacgctaaagttttct
gggaacgtatcgaagagcttcaggactctgaaaaagtgctcagtcaaattgagaagggcg
aggcacgaattcaacgaaaatatgctgtgaagaaggcgcttgacgctaaaatagcaaagt
acaaggctccgtttcaacagttgcgtatttcctatggtacaaataaaggaaaaacgtaca
ccgaagaagaggatcgattcctggtttgtgagactcatcgattgggacatgataaggaaa
atgtgttcgaagagctgcgtcagtctgttcgcatggcaccacaattcagatttgattggt
tcctgaagagtcgtacagcaatggagcttcaacgccgttgcaatactcttattactttga
tagaacgtgaaatgggagaagttgtggagtcaaagcctgtcatcgtgaccgctgccgata
agaagaaatctgtcgctaaggacctgtca

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
AACGCGAGTTCCAACAGTTTGTTAG 52 145 2309 Antisense
GAAGGGCGAGGCACGAATTCAACGA 541 331 2481 Antisense
ACAAGGCTCCGTTTCAACAGTTGCG 108 113 2549 Antisense
AACAGTTGCGTATTTCCTATGGTAC 29 135 2564 Antisense
GATCGATTCCTGGTTTGTGAGACTC 602 417 2620 Antisense
AAGAGCTGCGTCAGTCTGTTCGCAT 210 155 2678 Antisense
CTGTTCGCATGGCACCACAATTCAG 161 225 2693 Antisense
ACAGCAATGGAGCTTCAACGCCGTT 646 107 2743 Antisense
CAACGCCGTTGCAATACTCTTATTA 489 187 2758 Antisense
TCATCGTGACCGCTGCCGATAAGAA 170 619 2828 Antisense
GAAATCTGTCGCTAAGGACCTGTCA 273 361 2853 Antisense
Sequence Source Affymetrix Proprietary Database