|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
187255_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.9494
|
|
Exemplar sequence
|
|
D2024.3 NCBI
|
|
D2024.3 /REP_DB=WormBase Gene ID /WP=CE04292 /TR=SW:P49191 /GB=AAA82288.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_068746(9) |
|
|
|
|
|
NM_068746 NCBI |
Caenorhabditis elegans fatty acid ELOngation family member (elo-3) (elo-3) mRNA, complete cds. |
9/11 |
None |
SNAP00000033326 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:7237712:7239880:1 |
9/11 |
None |
D2024.3 ENSEMBL |
cdna:known chromosome:CEL140:IV:7237712:7239880:1 gene:D2024.3 |
9/11 |
None | |
GENEFINDER00000033333 |
8/11 |
Cross Hyb Matching Probes |
None | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:7237717-7239886(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
elo-3
|
|
D2024.3
|
|
183948 Entrez gene
|
|
P49191 EMBL-EBI
|
|
CE34783 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1588197_AT |
similar to ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
cfa |
CANINE_2:CFAAFFX.17954.1.S1_AT |
similar to ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
cfa |
DROSOPHILA_2:1637773_S_AT |
|
dm |
DROSGENOME1:153694_AT |
|
dm |
CHICKEN:GGA.7376.1.S1_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
gga |
CHICKEN:GGAAFFX.12469.1.S1_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
gga |
CHICKEN:GGAAFFX.12469.1.S1_S_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
gga |
HG-U95B:44328_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U133_PLUS_2:210868_S_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U133A:210868_S_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U133A_2:210868_S_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U133_PLUS_2:204256_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U133A_2:204256_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U133A:204256_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HU35KSUBB:RC_N51054_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HU35KSUBB:RC_AA233837_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
U133_X3P:G13129087_3P_X_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
U133_X3P:G13129087_3P_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
U133_X3P:G12654918_3P_A_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U95AV2:40943_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U95B:45605_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U95AV2:39481_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U95B:49721_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U95C:63684_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U95C:64861_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HG-U95D:86640_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HU35KSUBB:RC_T23759_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
HU35KSUBC:RC_W88954_AT |
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) |
hs |
MU11KSUBA:AA561252_S_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MU11KSUBA:C76452_RC_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MG-U74AV2:94418_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MG-U74AV2:103665_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MOE430A:1417404_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MOUSE430A_2:1417404_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MOUSE430_2:1417404_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MOE430A:1417403_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MOUSE430A_2:1417403_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MOUSE430_2:1417403_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
mm |
MOE430B:1445062_AT |
Myelination associated SUR4-like protein (Masr) |
mm |
MOUSE430_2:1445062_AT |
Myelination associated SUR4-like protein (Masr) |
mm |
MOE430B:1445578_AT |
Myelination associated SUR4-like protein (Masr) |
mm |
MOUSE430_2:1445578_AT |
Myelination associated SUR4-like protein (Masr) |
mm |
MU19KSUBB:TC32396_AT |
Myelination associated SUR4-like protein (Masr) |
mm |
RAT230_2:1394401_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
rn |
RAE230B:1394401_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
rn |
RG-U34C:RC_AI145640_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
rn |
RAE230A:1388108_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
rn |
RAT230_2:1388108_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
rn |
RAE230B:1382677_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
rn |
RAT230_2:1382677_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
rn |
RG-U34C:RC_AI102536_AT |
ELOVL family member 6, elongation of long chain fatty acids (yeast) |
rn | |
|
|
|
|
|
16021 |
integral to membrane |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
NP_501147 |
fatty acid ELOngation family member (elo-3) [Caenorhabditis elegans] gb|AAA82288.2| Fatty acid elongation protein 3 [Caenorhabditis elegans] sp|P49191|ELO3_CAEEL Putative fatty acid elongation protein |
1.0E-179 |
blast |
CAE61841 |
Hypothetical protein CBG05815 [Caenorhabditis briggsae] |
1.0E-172 |
blast |
EAL30565 |
GA17812-PA [Drosophila pseudoobscura] |
6.0E-60 | |
|
|
|
|
|
Pfam |
IPR002076 EMBL-EBI |
GNS1/SUR4 membrane protein |
5.1E-24 |
Pfam |
IPR002076 EMBL-EBI |
GNS1/SUR4 membrane protein |
1.0E-126 |
NP_501147.2 |
6 |
38-55,70-87,146-164,174-193,206-228,243-265 |
D2024.3 |
6 |
38-55,70-87,146-164,174-193,206-228,243-265 |
SNAP00000033326 |
6 |
38-55,70-87,146-164,174-193,206-228,243-265 | |
Sequence |
|
>C. ELEGANS:187255_AT
tcttcgttctctgaaattccgtcttccaaaacaaatggcaatggttgttactactctcca
acttgctcaaatggttatgggagtaatcatcggagtcactgtctaccgtatcaagtcatc
gggtgaatactgccaacagacatgggacaatttgggattatgctttggagtttatttcac
atatttccttcttttcgccaacttcttctaccatgcatatgttaagaaaaacaaccgtac
agtaaattatgaaaataattcaaaaaatttccccgatctcgttttaatttacctgagaaa
aaaggtttcaagaaaatcgaaaaatcggcaatgttcagaaaataattataaaattcaatt
ttcatcaaattttgttaatgttgatggaaaaaaacataagaaaacatatgaacttattct
tccaagaagaaaaatgaccacaattttaacttttctatttggaaaaaatcgaattttttc
gaaatatcagaaaaatcgaaaaaacatttcgattcctgttgatttcgaaattctggagcc
aaaagaagatatcaatgctaacatcgctgagccatccat
BLASTn GenBank NR |
|
|
|
|
|
|
TCTTCGTTCTCTGAAATTCCGTCTT |
604 |
617 |
693 |
Antisense |
GAAATTCCGTCTTCCAAAACAAATG |
492 |
363 |
705 |
Antisense |
GGCAATGGTTGTTACTACTCTCCAA |
265 |
535 |
729 |
Antisense |
GTAATCATCGGAGTCACTGTCTACC |
252 |
463 |
775 |
Antisense |
CACTGTCTACCGTATCAAGTCATCG |
163 |
199 |
789 |
Antisense |
GTCATCGGGTGAATACTGCCAACAG |
157 |
467 |
807 |
Antisense |
TTATTTCACATATTTCCTTCTTTTC |
651 |
679 |
864 |
Antisense |
CCAACTTCTTCTACCATGCATATGT |
284 |
277 |
890 |
Antisense |
CCGATCTCGTTTTAATTTACCTGAG |
198 |
263 |
965 |
Antisense |
AACATTTCGATTCCTGTTGATTTCG |
627 |
137 |
1195 |
Antisense |
ATGCTAACATCGCTGAGCCATCCAT |
496 |
41 |
1247 |
Antisense | |
|
Affymetrix Proprietary Database | |