|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
186483_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3968
|
|
Exemplar sequence
|
|
Y54G11A.11 NCBI
|
|
Y54G11A.11 /REP_DB=WormBase Gene ID /WP=CE22483 /TR=Q9XVZ8 /GB=CAA22454.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_064582(11) |
|
|
|
|
|
NM_064582 NCBI |
Caenorhabditis elegans Y54G11A.11 (Y54G11A.11) mRNA, complete cds. |
11/11 |
None |
SNAP00000023656 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:14340386:14350370:1 |
11/11 |
None |
GENEFINDER00000023686 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:14350067:14350370:1 |
11/11 |
None |
Y54G11A.11 ENSEMBL |
cdna:known chromosome:CEL140:II:14350041:14350697:1 gene:Y54G11A.11 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:14350063-14350367(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
Y54G11A.11
|
|
175090 Entrez gene
|
|
Q9XVZ8 EMBL-EBI
|
|
CE22483 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:248884_AT |
expressed protein |
at |
HU35KSUBA:RC_AA455267_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
hs |
U133_X3P:HS.326422.0.S1_3P_X_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
hs |
U133_X3P:HS.326422.0.S1_3P_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
hs |
HG-U133_PLUS_2:225156_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
hs |
HG-U133B:225156_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
hs |
HG-U95B:51139_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
hs |
MG-U74AV2:95760_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
mm |
MG-U74BV2:164409_I_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
mm |
MG-U74CV2:170864_I_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
mm |
MG-U74CV2:170333_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
mm |
MOE430A:1423820_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
mm |
MOUSE430A_2:1423820_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
mm |
MOUSE430_2:1423820_AT |
elongation factor 1 homolog (ELF1, S. cerevisiae) |
mm |
MU19KSUBB:TC34443_I_AT |
Elongation factor 1 homolog (ELF1, S. cerevisiae), mRNA (cDNA clone MGC:37411 IMAGE:4981209) |
mm |
MU19KSUBB:TC34443_R_AT |
Elongation factor 1 homolog (ELF1, S. cerevisiae), mRNA (cDNA clone MGC:37411 IMAGE:4981209) |
mm |
MU19KSUBB:TC34443_S_AT |
Elongation factor 1 homolog (ELF1, S. cerevisiae), mRNA (cDNA clone MGC:37411 IMAGE:4981209) |
mm |
MU19KSUBC:TC36895_AT |
Elongation factor 1 homolog (ELF1, S. cerevisiae), mRNA (cDNA clone MGC:37411 IMAGE:4981209) |
mm |
RAE230A:1371515_AT |
Similar to RIKEN cDNA 1110011K10 (predicted) |
rn |
RAT230_2:1371515_AT |
Similar to RIKEN cDNA 1110011K10 (predicted) |
rn |
YEAST_2:1779859_AT |
Transcription elongation factor that contains a conserved zinc finger domain; implicated in the maintenance of proper chromatin structure in actively transcribed regions; deletion inhibits Brome mosaic virus (BMV) gene expression |
Sc | |
|
|
|
|
|
blast |
CAA22454 |
Hypothetical protein Y54G11A.11 [Caenorhabditis elegans] ref|NP_496983.1| Y54G11A.11 [Caenorhabditis elegans] sp|Q9XVZ8|U222_CAEEL Hypothetical UPF0222 protein Y54G11A.11 in chromosome II |
2.0E-45 |
blast |
CAE65930 |
Hypothetical protein CBG11103 [Caenorhabditis briggsae] |
1.0E-44 |
blast |
AAM76200 |
RE67573p [Drosophila melanogaster] gb|EAA46293.1| CG40228-PA.3 [Drosophila melanogaster] ref|NP_001015130.1| CG40228-PA.3 [Drosophila melanogaster] sp|Q8MQI6|U222_DROME Hypothetical UPF0222 protein CG40228 |
6.0E-32 | |
|
|
|
|
|
Pfam |
IPR007808 EMBL-EBI |
Putative zinc binding domain DUF701 |
8.7E-40 |
Pfam |
IPR007808 EMBL-EBI |
Putative zinc binding domain DUF701 |
8.7E-40 | |
Sequence |
|
>C. ELEGANS:186483_AT
gaaaggctccaaccaaggcaaaggctgtaatgccactcgacacccaattcaactgtccgt
tttgcaatcatgaacgcgtttgtgaagtgaaaatggatcgcgaaaagaatgtcggttata
tctcgtgtcgtgtctgctctgaagacttccaaacaaacatcaactacctctccgagccaa
tcgacgtctattctgattgggtg
BLASTn GenBank NR |
|
|
|
|
|
|
GAAAGGCTCCAACCAAGGCAAAGGC |
300 |
359 |
35 |
Antisense |
GGCAAAGGCTGTAATGCCACTCGAC |
340 |
535 |
51 |
Antisense |
TCGACACCCAATTCAACTGTCCGTT |
67 |
599 |
71 |
Antisense |
TCAACTGTCCGTTTTGCAATCATGA |
660 |
629 |
83 |
Antisense |
GCAATCATGAACGCGTTTGTGAAGT |
110 |
323 |
98 |
Antisense |
GAATGTCGGTTATATCTCGTGTCGT |
173 |
333 |
141 |
Antisense |
CTCGTGTCGTGTCTGCTCTGAAGAC |
139 |
233 |
156 |
Antisense |
GTGTCTGCTCTGAAGACTTCCAAAC |
284 |
487 |
164 |
Antisense |
TCCAAACAAACATCAACTACCTCTC |
514 |
585 |
182 |
Antisense |
TCCGAGCCAATCGACGTCTATTCTG |
225 |
595 |
205 |
Antisense |
AATCGACGTCTATTCTGATTGGGTG |
215 |
169 |
213 |
Antisense | |
|
Affymetrix Proprietary Database |