|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
182546_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3019
|
|
Exemplar sequence
|
|
Y46G5A.2 NCBI
|
|
Y46G5A.2 /REP_DB=WormBase Gene ID /WP=CE24292 /TR=Q9U2G3 /GB=CAB60348.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_064307(11) |
|
|
|
|
|
NM_064307 NCBI |
Caenorhabditis elegans Y46G5A.2 (Y46G5A.2) mRNA, complete cds. |
11/11 |
None |
SNAP00000038983 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:12681614:12692794:1 |
11/11 |
None |
GENEFINDER00000039026 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:12681485:12686807:1 |
11/11 |
None |
Y46G5A.2 ENSEMBL |
cdna:known chromosome:CEL140:II:12679851:12686306:1 gene:Y46G5A.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:12681627-12685677(+) |
91.83 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
Y46G5A.2
|
|
174899 Entrez gene
|
|
Q9U2G3 EMBL-EBI
|
|
CE35917 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFAAFFX.27395.1.S1_AT |
similar to heme A:farnesyltransferase |
cfa |
DROSOPHILA_2:1634270_AT |
|
dm |
DROSGENOME1:154662_AT |
|
dm |
CHICKEN:GGAAFFX.12399.1.S1_S_AT |
similar to COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase |
gga |
CHICKEN:GGAAFFX.21381.2.S1_S_AT |
similar to COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase |
gga |
CHICKEN:GGAAFFX.882.2.S1_S_AT |
similar to COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase |
gga |
HG-U133_PLUS_2:203858_S_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HG-U133A:203858_S_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HG-FOCUS:203858_S_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HG-U133A_2:203858_S_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HUGENEFL:U82010_RNA1_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
U133_X3P:G4502978_3P_S_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
U133_X3P:203858_3P_S_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HG-U95AV2:37224_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HG-U95E:84445_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HG-U133_PLUS_2:239402_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HG-U133B:239402_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
HG-U95E:76153_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
U133_X3P:HS.117298.0.A1_3P_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
hs |
MOUSE430_2:1459977_X_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
mm |
MOE430B:1459977_X_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
mm |
MG-U74BV2:107002_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
mm |
MOE430B:1429329_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
mm |
MOUSE430_2:1429329_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) |
mm |
MG-U74BV2:116152_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast), mRNA (cDNA clone MGC:47032 IMAGE:4206826) |
mm |
MOE430B:1435380_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast), mRNA (cDNA clone MGC:47032 IMAGE:4206826) |
mm |
MOUSE430_2:1435380_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast), mRNA (cDNA clone MGC:47032 IMAGE:4206826) |
mm |
MOE430B:1446223_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast), mRNA (cDNA clone MGC:47032 IMAGE:4206826) |
mm |
MOUSE430_2:1446223_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast), mRNA (cDNA clone MGC:47032 IMAGE:4206826) |
mm |
MU19KSUBB:TC28206_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast), mRNA (cDNA clone MGC:47032 IMAGE:4206826) |
mm |
MU19KSUBC:TC38962_AT |
COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast), mRNA (cDNA clone MGC:47032 IMAGE:4206826) |
mm |
YEAST_2:1775746_AT |
Heme A:farnesyltransferase, catalyzes the first step in the conversion of protoheme to the heme A prosthetic group required for cytochrome c oxidase activity; human ortholog is associated with mitochondrial disorders |
Sc | |
|
|
|
|
|
6783 |
heme biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16021 |
integral to membrane |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
8495 |
protoheme IX farnesyltransferase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB60348 |
Hypothetical protein Y46G5A.2 [Caenorhabditis elegans] emb|CAE48674.1| Hypothetical protein Y46G5A.2 [Caenorhabditis elegans] ref|NP_496708.2| Y46G5A.2 [Caenorhabditis elegans] |
0.0 |
blast |
CAB60348 |
Hypothetical protein Y46G5A.2 [Caenorhabditis elegans] emb|CAE48674.1| Hypothetical protein Y46G5A.2 [Caenorhabditis elegans] ref|NP_496708.2| Y46G5A.2 [Caenorhabditis elegans] |
1.0E-153 |
blast |
CAB60348 |
Hypothetical protein Y46G5A.2 [Caenorhabditis elegans] emb|CAE48674.1| Hypothetical protein Y46G5A.2 [Caenorhabditis elegans] ref|NP_496708.2| Y46G5A.2 [Caenorhabditis elegans] |
1.0E-139 |
blast |
CAE63454 |
Hypothetical protein CBG07915 [Caenorhabditis briggsae] |
1.0E-128 |
blast |
CAE63454 |
Hypothetical protein CBG07915 [Caenorhabditis briggsae] |
1.0E-127 |
blast |
XP_786048 |
PREDICTED: similar to COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase [Strongylocentrotus purpuratus] |
2.0E-69 | |
|
|
|
|
|
Pfam |
IPR000537 EMBL-EBI |
UbiA prenyltransferase |
1.1E-53 |
Pfam |
IPR000537 EMBL-EBI |
UbiA prenyltransferase |
1.5E-50 |
Pfam |
IPR000537 EMBL-EBI |
UbiA prenyltransferase |
1.1E-53 |
NP_496708.2 |
8 |
100-119,123-145,166-188,193-210,217-239,244-266,297-319,347-364 |
Y46G5A.2 |
8 |
100-119,123-145,166-188,193-210,217-239,244-266,297-319,347-364 |
SNAP00000038983 |
8 |
5-27,54-76,81-103,110-132,137-159,190-212,240-257,352-374 |
GENEFINDER00000039026 |
9 |
20-37,41-63,84-106,111-128,135-157,230-252,265-284,299-321,334-351 | |
Sequence |
|
>C. ELEGANS:182546_AT
tatttatgcaggcgtctacactccgatgaaacgttctcatatcggatgcacatgggccgg
agccgtagttggagcaattccaccactaatgggatatgctgcagccaccgggtacctgga
tccggctgcctggtgcctggcaactattcttttttcatggcaatttccacattttaatgg
tcttagctggaatttgagaggcgattatagtaaggccggctaccgcgtaatgtgtgtgac
aaatgagcggttgtgccgtgtgacgtcacttcgtcacagtgttgctctactcggattgtg
ctccatcgctgctccgcttacagacttgacaacgctcacctttgctatagattctcttcc
agtgaacgcgtacctcgtctacctatcctacaaattctacaaggctcccgacgcgaaaaa
cagtcgaaaattgttcttctactcactgttacatctgccgctggtcatgttac
BLASTn GenBank NR |
|
|
|
|
|
|
TATTTATGCAGGCGTCTACACTCCG |
339 |
661 |
282 |
Antisense |
TGCCTGGCAACTATTCTTTTTTCAT |
249 |
585 |
415 |
Antisense |
ATAGTAAGGCCGGCTACCGCGTAAT |
514 |
21 |
488 |
Antisense |
TGAGCGGTTGTGCCGTGTGACGTCA |
663 |
567 |
525 |
Antisense |
ACTTCGTCACAGTGTTGCTCTACTC |
654 |
103 |
549 |
Antisense |
TCCGCTTACAGACTTGACAACGCTC |
289 |
595 |
594 |
Antisense |
AACGCTCACCTTTGCTATAGATTCT |
25 |
147 |
612 |
Antisense |
AGATTCTCTTCCAGTGAACGCGTAC |
559 |
65 |
630 |
Antisense |
GTCTACCTATCCTACAAATTCTACA |
541 |
469 |
658 |
Antisense |
TTCTTCTACTCACTGTTACATCTGC |
125 |
691 |
715 |
Antisense |
TTACATCTGCCGCTGGTCATGTTAC |
504 |
681 |
730 |
Antisense | |
|
Affymetrix Proprietary Database | |