|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
177490_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.12600
|
|
Exemplar sequence
|
|
Y69H2.5 NCBI
|
|
Y69H2.5 /REP_DB=WormBase Gene ID /WP=CE22823 /TR=Q9U1U5 /GB=CAB63402.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade B annotation. |
|
NM_075241, NM_075243, NM_075244, NM_075242 |
|
|
|
|
|
GENEFINDER00000002606 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:18658765:18667381:-1 |
|
None |
NM_075242 NCBI |
Caenorhabditis elegans Y69H2.3a (Y69H2.3) mRNA, complete cds. |
|
A |
Y69H2.3b ENSEMBL |
cdna:known chromosome:CEL140:V:18658681:18666670:-1 gene:Y69H2.3 |
|
A |
Y69H2.3c ENSEMBL |
cdna:known chromosome:CEL140:V:18658765:18666670:-1 gene:Y69H2.3 |
|
A |
Y69H2.3d.1 ENSEMBL |
cdna:known chromosome:CEL140:V:18662165:18666690:-1 gene:Y69H2.3 |
|
None |
Y69H2.3a.2 ENSEMBL |
cdna:known chromosome:CEL140:V:18662272:18666692:-1 gene:Y69H2.3 |
|
None |
Y69H2.3a.1 ENSEMBL |
cdna:known chromosome:CEL140:V:18662272:18666690:-1 gene:Y69H2.3 |
|
None |
Y69H2.3d.2 ENSEMBL |
cdna:known chromosome:CEL140:V:18662170:18666692:-1 gene:Y69H2.3 |
|
None |
NM_075244 NCBI |
Caenorhabditis elegans Y69H2.3d (Y69H2.3) mRNA, complete cds. |
|
A |
NM_075243 NCBI |
Caenorhabditis elegans Y69H2.3b (Y69H2.3) mRNA, complete cds. |
|
A |
NM_075241 NCBI |
Caenorhabditis elegans Y69H2.3c (Y69H2.3) mRNA, complete cds. |
|
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:18666294-18666819(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
Y69H2.3
|
Functional Annotations |
|
|
|
|
|
blast |
CAB54473 |
Hypothetical protein Y69H2.3b [Caenorhabditis elegans] ref|NP_507644.2| Y69H2.3b [Caenorhabditis elegans] |
0.0 |
blast |
CAD56616 |
Hypothetical protein Y69H2.3c [Caenorhabditis elegans] ref|NP_507642.2| Y69H2.3c [Caenorhabditis elegans] |
0.0 |
blast |
CAE73283 |
Hypothetical protein CBG20701 [Caenorhabditis briggsae] |
0.0 |
blast |
CAD56617 |
Hypothetical protein Y69H2.3d [Caenorhabditis elegans] ref|NP_507645.2| Y69H2.3d [Caenorhabditis elegans] |
0.0 |
blast |
CAB54472 |
Hypothetical protein Y69H2.3a [Caenorhabditis elegans] ref|NP_507643.2| Y69H2.3a [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.6E-20 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
8.4E-11 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
3.3E-9 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.9E-9 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.1E-8 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
2.0E-9 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.7E-12 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.9E-9 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.1E-8 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
2.0E-9 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.7E-12 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
6.1E-17 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
6.1E-17 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.6E-20 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
8.4E-11 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
3.3E-9 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.9E-9 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.1E-8 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
2.0E-9 |
Pfam |
IPR002919 EMBL-EBI |
Trypsin inhibitor-like, cysteine-rich TIL region |
1.7E-12 | |
Sequence |
|
>C. ELEGANS:177490_AT
tgttttccgcacttttgatgtctgatttctcgattttctggtttttttattataatgttt
ttcctgaaactttatgttttgagtttccgagtttcggagcgatgcagtatattgtgctgc
tcagcgttctgctcatcggagcaaacgctcaactttcagcgacaagaggtaagtttttcc
aacctaaaagtgtacctaaacccctttcagaccaagaatgcaaagaaaacgagagcttcc
agacgtgtggcacggcttgcgagccgacttgcgggcttccgactccgactttttgcacac
tgcaatgcgtcatgggatgtcagtgtaacagtggattcttccgcagaacttcggataatc
gttgtgttgagcagaaggactgcaatgttgcggcgaat
BLASTn GenBank NR |
|
|
|
|
|
|
TGTTTTCCGCACTTTTGATGTCTGA |
360 |
561 |
14 |
Antisense |
TGATGTCTGATTTCTCGATTTTCTG |
26 |
567 |
29 |
Antisense |
TATGTTTTGAGTTTCCGAGTTTCGG |
175 |
651 |
86 |
Antisense |
ATATTGTGCTGCTCAGCGTTCTGCT |
328 |
19 |
122 |
Antisense |
GCGTTCTGCTCATCGGAGCAAACGC |
160 |
291 |
137 |
Antisense |
GAGCAAACGCTCAACTTTCAGCGAC |
213 |
391 |
152 |
Antisense |
AAACCCCTTTCAGACCAAGAATGCA |
468 |
107 |
211 |
Antisense |
TCCAGACGTGTGGCACGGCTTGCGA |
669 |
589 |
251 |
Antisense |
TGCACACTGCAATGCGTCATGGGAT |
57 |
577 |
307 |
Antisense |
ACAGTGGATTCTTCCGCAGAACTTC |
403 |
107 |
341 |
Antisense |
GAAGGACTGCAATGTTGCGGCGAAT |
1 |
335 |
387 |
Antisense | |
|
Affymetrix Proprietary Database |