|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
177391_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2723
|
|
Exemplar sequence
|
|
R166.3 NCBI
|
|
R166.3 /REP_DB=WormBase Gene ID /WP=CE03582 /TR=Q22004 /GB=CAA90664.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063869(11) |
|
|
|
|
|
NM_063869 NCBI |
Caenorhabditis elegans R166.3 (R166.3) mRNA, complete cds. |
11/11 |
None |
SNAP00000017513 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:10537836:10539242:-1 |
11/11 |
None |
GENEFINDER00000017522 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:10537836:10539242:-1 |
11/11 |
None |
R166.3 ENSEMBL |
cdna:known chromosome:CEL140:II:10537770:10539242:-1 gene:R166.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:10537832-10539239(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
R166.3
|
|
174621 Entrez gene
|
|
Q22004 EMBL-EBI
|
|
CE03582 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:14564_AT |
AMMECR1 family |
at |
ATH1-121501:266416_AT |
AMMECR1 family |
at |
CANINE_2:CFAAFFX.27720.1.S1_S_AT |
similar to AMME syndrome candidate gene 1 protein |
cfa |
DROSOPHILA_2:1638044_A_AT |
|
dm |
DROSGENOME1:141778_AT |
|
dm |
CHICKEN:GGAAFFX.5069.1.S1_AT |
similar to AMMECR1 protein |
gga |
HG-U95AV2:32940_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133_PLUS_2:204976_S_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133A_2:204976_S_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-FOCUS:204976_S_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133A:204976_S_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HU35KSUBA:RC_AA252395_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HU35KSUBB:RC_N55443_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
U133_X3P:HS2.326142.1.S1_3P_S_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
U133_X3P:HS.326142.0.S2_3P_S_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
U133_X3P:HS.23625.0.A1_3P_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133_PLUS_2:1553219_A_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133_PLUS_2:226421_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133B:226421_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U95B:43455_R_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U95C:49524_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U95B:50933_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HU35KSUBB:RC_N29755_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
U133_X3P:HS.17643.0.A1_3P_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133_PLUS_2:236760_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133B:236760_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U95C:62618_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133_PLUS_2:236791_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133B:236791_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133_PLUS_2:237148_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U133B:237148_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U95D:70679_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U95D:72521_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
HG-U95E:74400_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
U133_X3P:HS.129076.0.A1_3P_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
U133_X3P:HS.222068.0.A1_3P_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 |
hs |
MOUSE430_2:1430697_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog (human) |
mm |
MOE430B:1430697_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog (human) |
mm |
MOUSE430A_2:1450546_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog (human) |
mm |
MOUSE430_2:1450546_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog (human) |
mm |
MOE430A:1450546_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog (human) |
mm |
MU19KSUBA:TC25109_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog (human), mRNA (cDNA clone IMAGE:3674354) |
mm |
MU19KSUBB:TC34343_AT |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog (human), mRNA (cDNA clone IMAGE:3674354) |
mm | |
|
|
|
|
|
blast |
CAA90664 |
Hypothetical protein R166.3 [Caenorhabditis elegans] ref|NP_496270.1| R166.3 [Caenorhabditis elegans] sp|Q22004|AMER1_CAEEL Hypothetical protein R166.3 in chromosome II |
1.0E-116 |
blast |
CAE59658 |
Hypothetical protein CBG03076 [Caenorhabditis briggsae] |
3.0E-96 |
blast |
CAI41539 |
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 [Homo sapiens] emb|CAI42537.1| Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 [Homo sapiens] emb|CAI42703.1| Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 [Homo sapiens] |
3.0E-47 | |
|
|
|
|
|
Pfam |
IPR002733 EMBL-EBI |
Protein of unknown function DUF51 |
3.9E-122 | |
Sequence |
|
>C. ELEGANS:177391_S_AT
tgacgtccgctaacatccaaatggcagtttactgctttgacgtcatcaacgcccaattga
atcgagagaaggaacctcccgtgccaaaagagatccctaatgtaaaattaccactatttg
tcacatggaagaagggacatcaacacgatttacgcggatgcattggaactttctctgatt
taagattgggtgaggggttaaacgaatatgcgaagaccagcgctttccatgattcacgat
tcaagccaattagccgggaagaagttccaagtttgcagtgcggagtttctcttctaataa
acttcgagccaattcataattttcgtgactggacaatcggtcgtcatggagttcgaatga
atttcgacgatggtcatcgcaatcggagtgccgttttcttgccggaagtagctcaagaac
aaggatggaatcatgtggagacaattgatcatttaataagaaaaagtggatacggaggac
atattaatgatgctcttcggtcagcacttcgaattgttcgcttccaaagctccaaacttg
ttc
BLASTn GenBank NR |
|
|
|
|
|
|
TGACGTCCGCTAACATCCAAATGGC |
139 |
569 |
14 |
Antisense |
GCAGTTTACTGCTTTGACGTCATCA |
697 |
311 |
37 |
Antisense |
GACGTCATCAACGCCCAATTGAATC |
25 |
377 |
52 |
Antisense |
GGAACCTCCCGTGCCAAAAGAGATC |
179 |
243 |
84 |
Antisense |
CGCGGATGCATTGGAACTTTCTCTG |
504 |
255 |
166 |
Antisense |
ATATGCGAAGACCAGCGCTTTCCAT |
457 |
21 |
219 |
Antisense |
GCGCTTTCCATGATTCACGATTCAA |
38 |
289 |
233 |
Antisense |
GCAATCGGAGTGCCGTTTTCTTGCC |
389 |
321 |
392 |
Antisense |
TAATGATGCTCTTCGGTCAGCACTT |
383 |
635 |
498 |
Antisense |
CAGCACTTCGAATTGTTCGCTTCCA |
670 |
203 |
515 |
Antisense |
CGCTTCCAAAGCTCCAAACTTGTTC |
520 |
247 |
532 |
Antisense | |
|
Affymetrix Proprietary Database | |