[Home] | [Total List]

[177324_s_at]

Description F31E3.1 /REP_DB=WormBase Gene ID /WP=CE01241 /GEN=ceh-20 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation /DEF=ceh-20
Cluster 6grp_highest_10_10 > 51      6grp_high1_10_10 > 16      4grp_highest_8_8 > 59      4grp_high_8_8 > 25      6grp_highest_nonorm > 30      6grp_total > 16      4grp_total > 39      6grp_highest_sub > De      6grp_cgc > 23      6grp_high1_sub > De      6grp_cgc_sub > De      6grp_total_sub > Decrease      6grp_rule_based > S1      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 713
1 2 3 4 range
A 1321.8
(3)
P 		1075.4
(-0.3)
P 		879
(-3)
P 		1031.3
(-0.9)
P 		443
B 1592.3
(3)
P 		956.2
(-2.4)
P 		889.2
(-3)
P 		968.3
(-2.3)
P 		703
C 1467.2
(3)
P 		916
(-3)
P 		991
(-2.2)
P 		1125.4
(-0.7)
P 		551
avr 1460.4
(3) 		982.5
(-2.3) 		919.7
(-3) 		1041.7
(-1.6) 		541

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1327
1 2 3 4 5 6 range
A 1048.1
(1.7)
P 		1204.8
(3)
P 		501.8
(-3)
P 		925.5
(0.6)
P 		528.9
(-2.8)
P 		766.2
(-0.7)
P 		703
B 1102.6
(2.9)
P 		1110.1
(3)
P 		535.4
(-2.6)
P 		601.8
(-2)
P 		579
(-2.2)
P 		498.3
(-3)
P 		612
C 1825.6
(3)
P 		980.6
(-1)
P 		1062.4
(-0.6)
P 		611.4
(-2.7)
P 		605.6
(-2.7)
P 		552.3
(-3)
P 		1273
avr 1325.4
(3) 		1098.5
(1.2) 		699.9
(-2) 		712.9
(-1.9) 		571.2
(-3) 		605.6
(-2.7) 		754
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 357
1 2 3 4 range
A 481.3
(3)
P 		233.4
(-1.5)
P 		229.8
(-1.6)
P 		151
(-3)
P 		330
B 507.8
(3)
P 		236.2
(-2.4)
P 		206
(-3)
P 		206.3
(-3)
P 		302
C 485.7
(3)
P 		263.4
(-1.5)
P 		345.4
(0.2)
P 		189.8
(-3)
P 		296
avr 491.6
(3) 		244.3
(-1.8) 		260.4
(-1.5) 		182.4
(-3) 		309

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 567
1 2 3 4 5 6 range
A 193.2
(-1.4)
P 		428.5
(3)
P 		109.3
(-3)
P 		234.7
(-0.6)
P 		159.6
(-2.1)
P 		186.5
(-1.5)
P 		319
B 383.7
(3)
P 		369.5
(2.7)
P 		130
(-3)
P 		159.4
(-2.3)
P 		235.3
(-0.5)
P 		185.8
(-1.7)
P 		254
C 676.7
(3)
P 		299.2
(-1.1)
P 		270.4
(-1.4)
P 		122.9
(-3)
P 		196
(-2.2)
P 		184.9
(-2.3)
P 		554
avr 417.9
(3) 		365.7
(1.7) 		169.9
(-3) 		172.3
(-2.9) 		197
(-2.3) 		185.7
(-2.6) 		248
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 177324_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.6824
Sequence Type Exemplar sequence
Representative Public ID F31E3.1 NCBI
Target Description F31E3.1 /REP_DB=WormBase Gene ID /WP=CE01241 /GEN=ceh-20 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation /DEF=ceh-20
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_001027384(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_001027384 NCBI Caenorhabditis elegans C.Elegans Homeobox family member (ceh-20) (ceh-20) mRNA, complete cds. 11/11 None
SNAP00000009458 ENSEMBL cdna:SNAP chromosome:CEL140:III:6979818:6981457:1 11/11 None
GENEFINDER00000009465 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:6979818:6981457:1 11/11 None
F31E3.1 ENSEMBL cdna:known chromosome:CEL140:III:6979813:6981719:1 gene:F31E3.1 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:6979815-6981455(+) 100.0 100.0
Public Domain and Genome References
Gene Title
Gene Symbol ceh-20
Ensembl F31E3.1
Entrez Gene 3565545 Entrez gene
SwissProt P41779 EMBL-EBI
WormBase CE01241 Wormbase
Functional Annotations
Ortholog
ID Title Organism
CANINE:1602989_AT similar to pre B-cell leukemia transcription factor 1 isoform b cfa
CANINE_2:CFAAFFX.20576.1.S1_AT similar to pre B-cell leukemia transcription factor 1 isoform b cfa
CANINE_2:CFAAFFX.20581.1.S1_S_AT similar to pre B-cell leukemia transcription factor 1 isoform b cfa
DROSOPHILA_2:1633528_S_AT extradenticle dm
DROSGENOME1:153499_AT extradenticle dm
CHICKEN:GGA.3132.2.S1_A_AT pre-B-cell leukemia transcription factor 1 gga
HG-U133_PLUS_2:205253_AT pre-B-cell leukemia transcription factor 1 hs
HG-U133A_2:205253_AT pre-B-cell leukemia transcription factor 1 hs
HG-U133A:205253_AT pre-B-cell leukemia transcription factor 1 hs
HG-FOCUS:205253_AT pre-B-cell leukemia transcription factor 1 hs
HU35KSUBA:HUM_ALU_AT pre-B-cell leukemia transcription factor 1 hs
HU35KSUBB:HUM_ALU_AT pre-B-cell leukemia transcription factor 1 hs
HU35KSUBC:HUM_ALU_AT pre-B-cell leukemia transcription factor 1 hs
HU35KSUBD:HUM_ALU_AT pre-B-cell leukemia transcription factor 1 hs
HUGENEFL:HUM_ALU_AT pre-B-cell leukemia transcription factor 1 hs
HC-G110:HUM_ALU_AT pre-B-cell leukemia transcription factor 1 hs
HUGENEFL:M86546_AT pre-B-cell leukemia transcription factor 1 hs
U133_X3P:G4505622_3P_AT pre-B-cell leukemia transcription factor 1 hs
HG-U95AV2:32063_AT pre-B-cell leukemia transcription factor 1 hs
HG-U95E:84235_AT pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:233756_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133B:233756_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBA:H19378_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBA:D61676_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBA:RC_AA487202_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBB:RC_N67102_S_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBC:RC_D60411_S_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBD:RC_N55336_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.296685.0.S1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.296684.0.S1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.287948.0.S1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.21851.0.S2_3P_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.21851.0.S1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.17962.0.A1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.131936.0.A1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133A_2:212148_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:212148_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133A:212148_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133A_2:212151_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:212151_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133A:212151_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:232144_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133B:232144_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:233273_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133B:233273_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:235538_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133B:235538_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:240725_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133B:240725_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95AV2:33355_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95B:47999_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95D:90786_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:1562235_S_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133A_2:217617_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:217617_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133A:217617_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:239210_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133B:239210_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:241102_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133B:241102_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133_PLUS_2:242022_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U133B:242022_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95B:47861_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95B:56620_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95C:62868_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95C:63718_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95E:69620_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95D:71843_R_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95E:73481_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95E:79864_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95E:84333_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95E:89357_R_AT Pre-B-cell leukemia transcription factor 1 hs
HG-U95D:90137_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.106200.0.A1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.87134.0.A1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBB:RC_AA156542_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBB:RC_AA233177_AT Pre-B-cell leukemia transcription factor 1 hs
HU35KSUBB:RC_N63823_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.114122.0.A1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
U133_X3P:HS.313760.0.A1_3P_AT Pre-B-cell leukemia transcription factor 1 hs
MU11KSUBA:AF020197_AT pre B-cell leukemia transcription factor 1 mm
MU11KSUBB:MSA.372.0_AT pre B-cell leukemia transcription factor 1 mm
MU11KSUBB:MSA.34272.0_S_AT pre B-cell leukemia transcription factor 1 mm
MG-U74AV2:94804_AT pre B-cell leukemia transcription factor 1 mm
MG-U74AV2:94803_AT pre B-cell leukemia transcription factor 1 mm
MG-U74BV2:105649_AT pre B-cell leukemia transcription factor 1 mm
MOE430A:1425383_A_AT pre B-cell leukemia transcription factor 1 mm
MOUSE430A_2:1425383_A_AT pre B-cell leukemia transcription factor 1 mm
MOUSE430_2:1425383_A_AT pre B-cell leukemia transcription factor 1 mm
MOE430A:1449542_AT pre B-cell leukemia transcription factor 1 mm
MOUSE430A_2:1449542_AT pre B-cell leukemia transcription factor 1 mm
MOUSE430_2:1449542_AT pre B-cell leukemia transcription factor 1 mm
MOUSE430_2:1440954_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOE430B:1440954_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOUSE430_2:1442846_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOE430B:1442846_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MG-U74BV2:105161_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MG-U74BV2:105387_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOE430B:1440037_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOUSE430_2:1440037_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOE430B:1447096_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOUSE430_2:1447096_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOE430B:1458853_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MOUSE430_2:1458853_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MU19KSUBA:TC22141_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MU19KSUBA:TC24114_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
MU19KSUBC:TC35065_AT Pre B-cell leukemia transcription factor 1, mRNA (cDNA clone MGC:7546 IMAGE:3492658) mm
RAE230B:1398487_AT pre-B-cell leukemia transcription factor 1 (predicted) rn
RAT230_2:1398487_AT pre-B-cell leukemia transcription factor 1 (predicted) rn
RAE230B:1393966_AT pre-B-cell leukemia transcription factor 1 (predicted) rn
RAT230_2:1393966_AT pre-B-cell leukemia transcription factor 1 (predicted) rn
RAE230A:1373739_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
RAT230_2:1373739_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
RAE230B:1378458_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
RAT230_2:1378458_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
RAE230B:1380747_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
RAT230_2:1380747_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
RG-U34B:RC_AI060161_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
RG-U34B:RC_AI069976_F_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
RG-U34B:RC_AI069980_AT Pre-B-cell leukemia transcription factor 1 (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6355 regulation of transcription, DNA-dependent inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from direct assay QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
3700 transcription factor activity inferred from electronic annotation QuickGO AmiGO
5515 protein binding inferred from direct assay QuickGO AmiGO
3677 DNA binding traceable author statement QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA81691 C.elegans homeobox protein 20 [Caenorhabditis elegans] ref|NP_001022555.1| C.Elegans Homeobox family member (ceh-20) [Caenorhabditis elegans] sp|P41779|HM20_CAEEL Homeobox protein ceh-20 gb|AAC46471.1| Ceh-20 1.0E-175
blast CAE70060 Hypothetical protein CBG16494 [Caenorhabditis briggsae] 1.0E-163
blast AAN09379 CG8933-PC, isoform C [Drosophila melanogaster] gb|AAF48556.1| CG8933-PB, isoform B [Drosophila melanogaster] gb|AAF48555.1| CG8933-PA, isoform A [Drosophila melanogaster] ref|NP_727924.1| CG8933-PC, isoform C [Drosophila melanogaster] ref|NP_727923.1| CG8933-PB, isoform B [Drosophila melanogaster] ref|NP_523360.1| CG8933-PA, isoform A [Drosophila melanogaster] gb|AAL28613.1| LD03509p [Drosophila melanogaster] sp|P40427|EXD_DROME Homeobox protein extradenticle gb|AAC46903.1| extradenticle gb|AAC37182.1| extradenticle 2.0E-97
Protein Domains
Database ID Description E-Value
scop a.4.1.Homeodomain All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Homeodomain 9.00000028714845E-32
Pfam IPR001356 EMBL-EBI Homeobox 5.7E-18
Pfam IPR005542 EMBL-EBI PBX domain 1.0E-126
Sequence
Target Sequence 
>C. ELEGANS:177324_S_AT
cacgcaacacgtgaggtctctgctgaaggatcaatcacaagttcgcccaatagcacataa
ggaaatcgaacgaatggtttatataatccaacgaaaattcaatggaattcaagttcaact
caaacaatccacatgtgaggccgtcatgatcctcagaagcaggttccttgatgcccgccg
taaacggcgaaacttttcgaaacaagcgacagaagtgcttaatgaatatttctatggaca
cctctcaaatccatacccatcagaagaagcaaaagaagatctcgcaaggcagtgcaatat
tacagtatctcaggtttccaattggtttggaaataaacgaattcgctacaagaaaaatat
ggcaaaagctcaagaggaagccagtatgtatgctgccaaaaagaatgctcatgtaacatt
aggaggtatggctggaaatccatacggaatgcttcctggtgctgcagccgctgctggcct
attaaatccctacaat

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
CACGCAACACGTGAGGTCTCTGCTG 119 201 402 Antisense
AGGATCAATCACAAGTTCGCCCAAT 419 57 428 Antisense
AACAATCCACATGTGAGGCCGTCAT 220 135 524 Antisense
GGCCGTCATGATCCTCAGAAGCAGG 80 543 540 Antisense
TCAGAAGCAGGTTCCTTGATGCCCG 635 623 554 Antisense
GAATATTTCTATGGACACCTCTCAA 34 327 625 Antisense
CTCTCAAATCCATACCCATCAGAAG 28 231 643 Antisense
GTATCTCAGGTTTCCAATTGGTTTG 33 453 706 Antisense
GGAAGCCAGTATGTATGCTGCCAAA 285 531 777 Antisense
ATACGGAATGCTTCCTGGTGCTGCA 644 21 843 Antisense
TGCTGGCCTATTAAATCCCTACAAT 547 583 873 Antisense
Sequence Source Affymetrix Proprietary Database