|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
177110_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.19324
|
|
Exemplar sequence
|
|
Y38F2AL.C NCBI
|
|
Y38F2AL.C /REP_DB=WormBase Gene ID /WP=CE06290 /CHR=4 /FEA=Sanger Annotation /DEF=(ST.LOUIS) protein_id:AAF59473.1
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_067787(11) |
|
|
|
|
|
NM_067787 NCBI |
Caenorhabditis elegans Vacuolar H ATPase family member (vha-3) (vha-3) mRNA, complete cds. |
11/11 |
A |
SNAP00000023928 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:2308245:2315944:-1 |
11/11 |
None |
GENEFINDER00000023937 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:2315459:2317277:-1 |
11/11 |
None |
Y38F2AL.4 ENSEMBL |
cdna:known chromosome:CEL140:IV:2315459:2315944:-1 gene:Y38F2AL.4 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:2315464-2315950(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
vha-3
|
|
Y38F2AL.4
|
|
177018 Entrez gene
|
|
P34546 EMBL-EBI
|
|
CE06290 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:262924_S_AT |
vacuolar ATP synthase 16 kDa proteolipid subunit 2 / V-ATPase 16 kDa proteolipid subunit 2 (AVAP2) (AVA-P2) |
at |
ATGENOME1:15584_S_AT |
vacuolar ATP synthase 16 kDa proteolipid subunit 2 / V-ATPase 16 kDa proteolipid subunit 2 (AVAP2) (AVA-P2) |
at |
CANINE:1583550_S_AT |
similar to Vacuolar ATP synthase 16 kDa proteolipid subunit |
cfa |
CANINE:1583549_AT |
similar to Vacuolar ATP synthase 16 kDa proteolipid subunit |
cfa |
CANINE_2:CFAAFFX.29582.1.S1_S_AT |
similar to Vacuolar ATP synthase 16 kDa proteolipid subunit |
cfa |
DROSOPHILA_2:1632117_S_AT |
Vacuolar H+ ATPase 16kD subunit |
dm |
DROSGENOME1:141528_AT |
Vacuolar H+ ATPase 16kD subunit |
dm |
HG-U133_PLUS_2:200954_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-U133A:200954_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-U133A_2:200954_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HUGENEFL:M62762_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:G4502312_3P_X_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:G4502312_3P_S_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:G4502312_3P_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:4901150C_3P_X_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:4901150C_3P_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:36994_3P_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:200954_3P_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-U133A_2:36994_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-FOCUS:36994_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-U133_PLUS_2:36994_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-U133A:36994_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-U95AV2:36994_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-U95D:75090_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:HS2.435455.1.S1_3P_S_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
U133_X3P:HS.315448.0.A1_3P_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HG-U133_PLUS_2:1557986_S_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
HU35KSUBD:RC_D20331_AT |
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
hs |
MG-U74AV2:96919_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOE430A:1416392_A_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOUSE430_2:1416392_A_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOUSE430A_2:1416392_A_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOUSE430_2:1435732_X_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOE430A:1435732_X_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOUSE430A_2:1435732_X_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOUSE430_2:1438925_X_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOE430A:1438925_X_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MOUSE430A_2:1438925_X_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
MU11KSUBA:M64298_S_AT |
ATPase, H+ transporting, V0 subunit C |
mm |
RG-U34A:D10874_G_AT |
ATPase, H+ transporting, V0 subunit C |
rn |
RG-U34A:D10874_AT |
ATPase, H+ transporting, V0 subunit C |
rn |
RG-U34C:RC_AI177126_S_AT |
ATPase, H+ transporting, V0 subunit C |
rn |
RAE230A:1398755_AT |
ATPase, H+ transporting, V0 subunit C |
rn |
RAT230_2:1398755_AT |
ATPase, H+ transporting, V0 subunit C |
rn |
YEAST_2:1780211_AT |
Proteolipid subunit of the vacuolar H(+)-ATPase V0 sector (subunit c; dicyclohexylcarbodiimide binding subunit); required for vacuolar acidification and important for copper and iron metal ion homeostasis |
Sc | |
|
|
|
|
|
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
220 |
hydrogen-transporting ATPase V0 domain |
inferred from sequence similarity |
QuickGO AmiGO |
|
|
|
|
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
NP_001023451 |
Vacuolar H ATPase family member (vha-11) [Caenorhabditis elegans] gb|AAF59474.3| Vacuolar h atpase protein 11, isoform a [Caenorhabditis elegans] sp|Q9XXU9|VATC_CAEEL Vacuolar ATP synthase subunit C (V-ATPase C subunit) (Vacuolar proton pump C subunit) dbj|BAA75067.1| Vha11 protein [Caenorhabditis elegans] |
0.0 |
blast |
CAE70305 |
Hypothetical protein CBG16826 [Caenorhabditis briggsae] |
0.0 |
blast |
AAH83532 |
Atp6v1c1l protein [Danio rerio] ref|XP_686493.1| PREDICTED: similar to Atp6v1c1l protein [Danio rerio] |
1.0E-123 |
blast |
CAA82355 |
Hypothetical protein R10E11.2 [Caenorhabditis elegans] ref|NP_499166.1| Vacuolar H ATPase family member (vha-2) [Caenorhabditis elegans] ref|NP_500188.1| Vacuolar H ATPase family member (vha-3) [Caenorhabditis elegans] gb|AAF59473.1| Vacuolar h atpase protein 3 [Caenorhabditis elegans] sp|P34546|VATL2_CAEEL Vacuolar ATP synthase 16 kDa proteolipid subunit 2/3 dbj|BAA22596.1| VHA-2 [Caenorhabditis elegans] dbj|BAA75066.1| Vha3 protein [Caenorhabditis elegans] |
3.0E-70 |
blast |
CAA82355 |
Hypothetical protein R10E11.2 [Caenorhabditis elegans] ref|NP_499166.1| Vacuolar H ATPase family member (vha-2) [Caenorhabditis elegans] ref|NP_500188.1| Vacuolar H ATPase family member (vha-3) [Caenorhabditis elegans] gb|AAF59473.1| Vacuolar h atpase protein 3 [Caenorhabditis elegans] sp|P34546|VATL2_CAEEL Vacuolar ATP synthase 16 kDa proteolipid subunit 2/3 dbj|BAA22596.1| VHA-2 [Caenorhabditis elegans] dbj|BAA75066.1| Vha3 protein [Caenorhabditis elegans] |
8.0E-70 |
blast |
CAE70304 |
Hypothetical protein CBG16825 [Caenorhabditis briggsae] emb|CAE65134.1| Hypothetical protein CBG10000 [Caenorhabditis briggsae] |
1.0E-68 |
blast |
CAE70304 |
Hypothetical protein CBG16825 [Caenorhabditis briggsae] emb|CAE65134.1| Hypothetical protein CBG10000 [Caenorhabditis briggsae] |
4.0E-68 |
blast |
Q17046 |
Vacuolar ATP synthase 16 kDa proteolipid subunit gb|AAA29372.1| gene-12 encoded protein |
1.0E-66 | |
|
|
|
|
|
Pfam |
IPR002379 EMBL-EBI |
H+-transporting two-sector ATPase, C subunit |
2.7E-16 |
Pfam |
IPR002379 EMBL-EBI |
H+-transporting two-sector ATPase, C subunit |
1.4E-25 |
Pfam |
IPR004907 EMBL-EBI |
V-ATPase subunit C |
1.0E-126 |
Pfam |
IPR002379 EMBL-EBI |
H+-transporting two-sector ATPase, C subunit |
5.5E-22 |
Pfam |
IPR002379 EMBL-EBI |
H+-transporting two-sector ATPase, C subunit |
2.7E-16 |
Pfam |
IPR002379 EMBL-EBI |
H+-transporting two-sector ATPase, C subunit |
1.4E-25 |
NP_500188.1 |
4 |
15-37,58-78,98-120,133-155 |
Y38F2AL.4 |
4 |
15-37,58-78,98-120,133-155 |
SNAP00000023928 |
4 |
15-37,58-78,98-120,133-155 |
GENEFINDER00000023937 |
4 |
115-137,158-177,197-219,232-254 | |
Sequence |
|
>C. ELEGANS:177110_S_AT
cctacggaaccgccaaatctgccgtcggaatctgttcaatgggtgtcatgcgcccggagc
ttatcatgaagtctgtgattccggttattatggccggtatcatcggtatctacggtctcg
tcgtcgcgatggtcttgaagggaaaagtgacgtcggcaagtgctggttacgatttgaata
agggattcgctcacttggccgccggacttacgtgcggactttgtggattgggagccggat
atgctatcggaattgttggagacgccggagtccgtggaacagctcaacagccacgtcttt
tcgtcggaatgatccttatccttatcttctctgaagt
BLASTn GenBank NR |
|
|
|
|
|
|
CCTACGGAACCGCCAAATCTGCCGT |
290 |
267 |
113 |
Antisense |
ATCTGCCGTCGGAATCTGTTCAATG |
550 |
33 |
129 |
Antisense |
TTCAATGGGTGTCATGCGCCCGGAG |
645 |
685 |
147 |
Antisense |
GCGCCCGGAGCTTATCATGAAGTCT |
455 |
287 |
162 |
Antisense |
GATTCCGGTTATTATGGCCGGTATC |
683 |
429 |
189 |
Antisense |
CTCGTCGTCGCGATGGTCTTGAAGG |
410 |
229 |
229 |
Antisense |
GTGACGTCGGCAAGTGCTGGTTACG |
532 |
481 |
259 |
Antisense |
CGCCGGACTTACGTGCGGACTTTGT |
582 |
257 |
312 |
Antisense |
GGGAGCCGGATATGCTATCGGAATT |
296 |
495 |
342 |
Antisense |
GCCACGTCTTTTCGTCGGAATGATC |
647 |
279 |
402 |
Antisense |
TCCTTATCCTTATCTTCTCTGAAGT |
46 |
593 |
425 |
Antisense | |
|
Affymetrix Proprietary Database | |