|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
177070_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.481
|
|
Exemplar sequence
|
|
C30F8.2 NCBI
|
|
C30F8.2 /REP_DB=WormBase Gene ID /WP=CE25796 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation /DEF=vaculolar ATPase
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_059114(11) |
|
|
|
|
|
NM_059114 NCBI |
Caenorhabditis elegans Vacuolar H ATPase family member (vha-16) (vha-16) mRNA, complete cds. |
11/11 |
None |
SNAP00000028654 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:5080313:5082260:-1 |
11/11 |
None |
GENEFINDER00000028661 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:5080313:5082260:-1 |
11/11 |
None |
C30F8.2.1 ENSEMBL |
cdna:known chromosome:CEL140:I:5079918:5082282:-1 gene:C30F8.2 |
11/11 |
None |
C30F8.2.4 ENSEMBL |
cdna:known chromosome:CEL140:I:5079918:5082268:-1 gene:C30F8.2 |
11/11 |
None |
C30F8.2.3 ENSEMBL |
cdna:known chromosome:CEL140:I:5079918:5082284:-1 gene:C30F8.2 |
11/11 |
None |
C30F8.2.2 ENSEMBL |
cdna:known chromosome:CEL140:I:5079918:5082276:-1 gene:C30F8.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:5080312-5082260(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
vaculolar ATPase
|
|
vha-16
|
|
C30F8.2
|
|
172134 Entrez gene
|
|
Q95YD5 EMBL-EBI
|
|
CE29684 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:256988_S_AT |
H+-transporting two-sector ATPase, putative |
at |
CANINE:1604168_AT |
similar to ATPase, H+ transporting, lysosomal, V0 subunit D isoform 1 |
cfa |
CANINE:1587282_AT |
similar to ATPase, H+ transporting, lysosomal, V0 subunit D isoform 1 |
cfa |
CANINE_2:CFA.11159.1.S1_AT |
similar to ATPase, H+ transporting, lysosomal, V0 subunit D isoform 1 |
cfa |
CANINE_2:CFAAFFX.31171.1.S1_S_AT |
similar to ATPase, H+ transporting, lysosomal, V0 subunit D isoform 1 |
cfa |
DROSOPHILA_2:1633535_AT |
|
dm |
DROSGENOME1:154279_AT |
|
dm |
CHICKEN:GGA.7507.1.S1_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
gga |
HU35KSUBD:RC_W02219_S_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
HUGENEFL:X71490_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
U133_X3P:HS.106876.0.A1_3P_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
HG-U133A_2:212041_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
HG-U133_PLUS_2:212041_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
HG-U133A:212041_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
HG-U95AV2:38686_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
HG-U133_PLUS_2:239633_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
HG-U133B:239633_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
HG-U95D:83499_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
U133_X3P:HS.156912.0.A1_3P_AT |
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1 |
hs |
MOE430A:1415671_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 |
mm |
MOE430B:1415671_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 |
mm |
MOUSE430A_2:1415671_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 |
mm |
MOUSE430_2:1415671_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 |
mm |
MU11KSUBA:U21549_S_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 |
mm |
MG-U74AV2:92603_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 |
mm |
MG-U74CV2:169598_R_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 |
mm |
MG-U74CV2:169049_R_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 |
mm |
MOE430B:1442216_AT |
ATPase, H+ transporting, V0 subunit D isoform 1, mRNA (cDNA clone MGC:18332 IMAGE:3662404) |
mm |
MOUSE430_2:1442216_AT |
ATPase, H+ transporting, V0 subunit D isoform 1, mRNA (cDNA clone MGC:18332 IMAGE:3662404) |
mm |
MG-U74CV2:129098_AT |
ATPase, H+ transporting, V0 subunit D isoform 1, mRNA (cDNA clone MGC:18332 IMAGE:3662404) |
mm |
MU19KSUBA:TC23661_S_AT |
ATPase, H+ transporting, V0 subunit D isoform 1, mRNA (cDNA clone MGC:18332 IMAGE:3662404) |
mm |
MU19KSUBC:TC39879_AT |
ATPase, H+ transporting, V0 subunit D isoform 1, mRNA (cDNA clone MGC:18332 IMAGE:3662404) |
mm |
RG-U34C:RC_AI169494_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 (predicted) |
rn |
RAE230A:1388365_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 (predicted) |
rn |
RAT230_2:1388365_AT |
ATPase, H+ transporting, V0 subunit D isoform 1 (predicted) |
rn |
YEAST_2:1777524_AT |
Subunit D of the five-subunit V0 integral membrane domain of vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found in the endomembrane system; stabilizes VO subunits; required for V1 domain assembly on the vacuolar membrane |
Sc | |
|
|
|
|
|
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAK85455 |
Vacuolar h atpase protein 16 [Caenorhabditis elegans] ref|NP_491515.2| Vacuolar H ATPase family member (vha-16) [Caenorhabditis elegans] |
0.0 |
blast |
EAL32225 |
GA15530-PA [Drosophila pseudoobscura] |
1.0E-163 | |
|
|
|
|
|
Pfam |
IPR002843 EMBL-EBI |
H+-transporting two-sector ATPase, C (AC39) subunit |
1.0E-126 | |
Sequence |
|
>C. ELEGANS:177070_S_AT
cttctactccagctgagctctacaatgccgttcttgtcgatacaccactcgctaactact
ttgtcgactgcatcaacgagcaagatttggacgagatgaatgttgaggttatccgtaata
ctctctacaaggcttacatcgaggacttttacaagttctgtgcaggactcggaggaaaga
ccgctgaagtcatgtgcgacattcttgctttcgaagctgatcgtcgttcgatcatcatca
ccatcaactcattcgacaccgagttgagcaaggatgatcgtcaaaagttgtatccacgtt
gcggaaaactattcccagatggtttgactggactctctcgtgctgatgattatgatcaag
tgaaacaagtttgcgaattctactctgattataagccacttttcgaaggatctggaaatg
gaccaggagagaagactttggaggataaattctttgagcacgaggttaaattgaatgtcc
actcttatcttcatcaattccactttggagtcttctacgcattcatcaaactgaaggagc
aagaaatgcgtaatatcatctggatcgccgaatgcatctcg
BLASTn GenBank NR |
|
|
|
|
|
|
CTTCTACTCCAGCTGAGCTCTACAA |
212 |
221 |
419 |
Antisense |
GCTCTACAATGCCGTTCTTGTCGAT |
270 |
301 |
435 |
Antisense |
CACCACTCGCTAACTACTTTGTCGA |
308 |
203 |
461 |
Antisense |
ACTTTGTCGACTGCATCAACGAGCA |
94 |
103 |
476 |
Antisense |
GAGGTTATCCGTAATACTCTCTACA |
185 |
403 |
523 |
Antisense |
AGACCGCTGAAGTCATGTGCGACAT |
199 |
71 |
596 |
Antisense |
CAGATGGTTTGACTGGACTCTCTCG |
265 |
205 |
734 |
Antisense |
GACTCTCTCGTGCTGATGATTATGA |
684 |
373 |
749 |
Antisense |
TGAATGTCCACTCTTATCTTCATCA |
557 |
575 |
890 |
Antisense |
TTTGGAGTCTTCTACGCATTCATCA |
56 |
667 |
922 |
Antisense |
CATCTGGATCGCCGAATGCATCTCG |
641 |
211 |
975 |
Antisense | |
|
Affymetrix Proprietary Database | |