|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
177008_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.18935
|
|
Exemplar sequence
|
|
Y55D5A.C NCBI
|
|
Y55D5A.C /REP_DB=WormBase Gene ID /WP=CE26186 /CHR=3 /FEA=Sanger Annotation /DEF=(ST.LOUIS) protein_id:AAG23452.1
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_065249(11) |
|
|
|
|
|
NM_065249 NCBI |
Caenorhabditis elegans abnormal DAuer Formation family member (daf-2) (daf-2) mRNA, complete cds. |
11/11 |
A |
SNAP00000010554 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:2993926:3052047:-1 |
11/11 |
None |
GENEFINDER00000010558 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:2995909:3023699:-1 |
11/11 |
None |
Y55D5A.5 ENSEMBL |
cdna:known chromosome:CEL140:III:2995753:3028790:-1 gene:Y55D5A.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:3005547-3006020(-) |
90.93 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
daf-2
|
|
Y55D5A.5
|
|
175410 Entrez gene
|
|
Q968Y9 EMBL-EBI
|
|
CE27499 Wormbase
|
Functional Annotations |
|
|
|
|
|
|
|
6468 |
protein amino acid phosphorylation |
inferred from electronic annotation |
QuickGO AmiGO |
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
5887 |
integral to plasma membrane |
inferred from sequence similarity |
QuickGO AmiGO |
|
|
|
|
4672 |
protein kinase activity |
inferred from electronic annotation |
QuickGO AmiGO |
4674 |
protein serine/threonine kinase activity |
inferred from electronic annotation |
QuickGO AmiGO |
4713 |
protein-tyrosine kinase activity |
inferred from electronic annotation |
QuickGO AmiGO |
4714 |
transmembrane receptor protein tyrosine kinase activity |
inferred from electronic annotation |
QuickGO AmiGO |
5006 |
epidermal growth factor receptor activity |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
5009 |
insulin receptor activity |
inferred from sequence similarity |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from sequence similarity |
QuickGO AmiGO |
17046 |
peptide hormone binding |
inferred from sequence similarity |
QuickGO AmiGO |
42169 |
SH2 domain binding |
inferred from sequence similarity |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAK29947 |
Abnormal dauer formation protein 2 [Caenorhabditis elegans] ref|NP_497650.3| abnormal DAuer Formation family member (daf-2) [Caenorhabditis elegans] |
0.0 |
blast |
AAC47715 |
insulin receptor homolog [Caenorhabditis elegans] |
0.0 |
blast |
CAE69523 |
Hypothetical protein CBG15732 [Caenorhabditis briggsae] |
0.0 |
blast |
AAQ90014 |
dauer abnormal formation-2 precursor [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.7E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.1E-4 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
4.3E-67 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
8.2E-36 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.7E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.1E-4 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
4.3E-67 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
3.2E-27 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
7.9E-12 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
8.2E-36 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.7E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.1E-4 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
4.3E-67 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
4.3E-44 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
8.2E-36 |
NP_497650.3 |
2 |
1182-1204,1307-1324 |
Y55D5A.5 |
2 |
1182-1204,1307-1324 |
SNAP00000010554 |
2 |
954-976,1079-1096 |
GENEFINDER00000010558 |
2 |
1296-1318,1421-1438 | |
Sequence |
|
>C. ELEGANS:177008_S_AT
gtgagacgatcaattgaagacgcgaatcgagtcagtgaagagttggaaaaagctgaaaat
ttgggaaaagctccaaaaactctcggtggaaagaagccgctgatccatatttcgaagaag
aagccgtcgagcagcagcaccacatccacaccggctccaacgatcgcatcaatgtatgcc
ttaacaaggaaaccgactacggtgccgggaacaaggattcggctctacgagatctacgaa
cctttacccggaagctgggcgattaatgtatcagctctggcattggataatagtt
BLASTn GenBank NR |
|
|
|
|
|
|
GTGAGACGATCAATTGAAGACGCGA |
27 |
483 |
19 |
Antisense |
GAAGACGCGAATCGAGTCAGTGAAG |
491 |
339 |
34 |
Antisense |
AACTCTCGGTGGAAAGAAGCCGCTG |
83 |
141 |
96 |
Antisense |
AAGCCGCTGATCCATATTTCGAAGA |
65 |
149 |
112 |
Antisense |
GCTCCAACGATCGCATCAATGTATG |
647 |
297 |
172 |
Antisense |
CTACGGTGCCGGGAACAAGGATTCG |
590 |
225 |
215 |
Antisense |
AGGATTCGGCTCTACGAGATCTACG |
543 |
55 |
232 |
Antisense |
TACGAGATCTACGAACCTTTACCCG |
586 |
647 |
244 |
Antisense |
TTTACCCGGAAGCTGGGCGATTAAT |
512 |
1 |
261 |
Antisense |
GGGCGATTAATGTATCAGCTCTGGC |
508 |
491 |
275 |
Antisense |
TCAGCTCTGGCATTGGATAATAGTT |
290 |
625 |
289 |
Antisense | |
|
Affymetrix Proprietary Database |