|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
176645_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.172
|
|
Exemplar sequence
|
|
C32E8.10E NCBI
|
|
C32E8.10E /REP_DB=WormBase Gene ID /WP=CE23565 /GEN=unc-11 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_058829(11), NM_001025845(11), NM_001025843(11), NM_001025844(11), NM_058827(11), NM_058826(11), NM_058828(11) |
|
|
|
|
|
NM_058829 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-11) (unc-11) mRNA, complete cds. |
11/11 |
None |
NM_001025845 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-11) (unc-11) mRNA, complete cds. |
11/11 |
None |
NM_001025843 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-11) (unc-11) mRNA, complete cds. |
11/11 |
None |
NM_001025844 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-11) (unc-11) mRNA, complete cds. |
11/11 |
None |
NM_058827 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-11) (unc-11) mRNA, complete cds. |
11/11 |
None |
NM_058826 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-11) (unc-11) mRNA, complete cds. |
11/11 |
None |
NM_058828 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-11) (unc-11) mRNA, complete cds. |
11/11 |
None |
SNAP00000040657 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:3799207:3805706:-1 |
11/11 |
None |
GENEFINDER00000040668 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:3799207:3806810:-1 |
11/11 |
None |
C32E8.10c ENSEMBL |
cdna:known chromosome:CEL140:I:3798463:3805720:-1 gene:C32E8.10 |
11/11 |
A |
C32E8.10f ENSEMBL |
cdna:known chromosome:CEL140:I:3799126:3805706:-1 gene:C32E8.10 |
11/11 |
A |
C32E8.10e ENSEMBL |
cdna:known chromosome:CEL140:I:3799173:3805706:-1 gene:C32E8.10 |
11/11 |
None |
C32E8.10b ENSEMBL |
cdna:known chromosome:CEL140:I:3799173:3805706:-1 gene:C32E8.10 |
11/11 |
A |
C32E8.10h ENSEMBL |
cdna:known chromosome:CEL140:I:3799173:3805706:-1 gene:C32E8.10 |
11/11 |
A |
C32E8.10d ENSEMBL |
cdna:known chromosome:CEL140:I:3799207:3805706:-1 gene:C32E8.10 |
11/11 |
A |
C32E8.10a ENSEMBL |
cdna:known chromosome:CEL140:I:3799207:3805706:-1 gene:C32E8.10 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:3799172-3805706(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
C32E8.10
|
Functional Annotations |
|
|
|
|
|
blast |
AAK68218 |
Uncoordinated protein 11, isoform h [Caenorhabditis elegans] ref|NP_001021016.1| UNCoordinated family member (unc-11) [Caenorhabditis elegans] gb|AAD37366.1| AP180-like adaptor protein [Caenorhabditis elegans] |
0.0 |
blast |
AAK68213 |
Uncoordinated protein 11, isoform b [Caenorhabditis elegans] ref|NP_001021014.1| UNCoordinated family member (unc-11) [Caenorhabditis elegans] gb|AAD37367.1| AP180-like adaptor protein [Caenorhabditis elegans] |
0.0 |
blast |
AAK68212 |
Uncoordinated protein 11, isoform a [Caenorhabditis elegans] ref|NP_491227.1| UNCoordinated family member (unc-11) [Caenorhabditis elegans] gb|AAD37365.1| AP180-like adaptor protein [Caenorhabditis elegans] sp|Q9XZI6|PICA_CAEEL Phosphatidylinositol-binding clathrin assembly protein unc-11 (AP180-like adaptor protein) (Uncoordinated protein 11) |
0.0 |
blast |
AAK68216 |
Uncoordinated protein 11, isoform e [Caenorhabditis elegans] ref|NP_001021015.1| UNCoordinated family member (unc-11) [Caenorhabditis elegans] |
0.0 |
blast |
AAK68215 |
Uncoordinated protein 11, isoform d [Caenorhabditis elegans] ref|NP_491229.1| UNCoordinated family member (unc-11) [Caenorhabditis elegans] |
0.0 |
blast |
AAK68214 |
Uncoordinated protein 11, isoform c [Caenorhabditis elegans] ref|NP_491228.1| UNCoordinated family member (unc-11) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR001026 EMBL-EBI |
Epsin N-terminal homology |
1.1E-44 |
Pfam |
IPR001026 EMBL-EBI |
Epsin N-terminal homology |
1.1E-44 | |
Sequence |
|
>C. ELEGANS:176645_S_AT
acaaagttgccgaattccttcgcgtcgccgaatccgtcggaatcgaccgtggagagattc
cagatttgacacgtgctccagcgagtcttctcgaagcacttgaagctcatctcatccatc
tcgaaggaggaaaagctccaccaccaactcaacaacatgttgcaccacatcaattcacca
ctggattcgcattttctcaacaaccacaaccggcacttggtgacgctgaacgacaacggt
atattgagttggaacaagagagattgagacagtttgaagatcagaagaaatcgattaatt
ctgcaaatccattcgcaaatgatgtcgcttcggctg
BLASTn GenBank NR |
|
|
|
|
|
|
ACAAAGTTGCCGAATTCCTTCGCGT |
503 |
111 |
797 |
Antisense |
GTCGCCGAATCCGTCGGAATCGACC |
98 |
475 |
820 |
Antisense |
AGATTCCAGATTTGACACGTGCTCC |
496 |
65 |
851 |
Antisense |
GCTCCAGCGAGTCTTCTCGAAGCAC |
126 |
299 |
871 |
Antisense |
AGGAGGAAAAGCTCCACCACCAACT |
47 |
57 |
921 |
Antisense |
ATGTTGCACCACATCAATTCACCAC |
364 |
47 |
953 |
Antisense |
TCAATTCACCACTGGATTCGCATTT |
419 |
633 |
966 |
Antisense |
CAACCACAACCGGCACTTGGTGACG |
360 |
187 |
997 |
Antisense |
GACGCTGAACGACAACGGTATATTG |
157 |
375 |
1018 |
Antisense |
TAATTCTGCAAATCCATTCGCAAAT |
170 |
635 |
1092 |
Antisense |
TTCGCAAATGATGTCGCTTCGGCTG |
703 |
693 |
1108 |
Antisense | |
|
Affymetrix Proprietary Database |