|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
175997_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.18765
|
|
Exemplar sequence
|
|
Y105E8B.U NCBI
|
|
Y105E8B.U /REP_DB=WormBase Gene ID /WP=CE25165 /CHR=1 /FEA=Sanger Annotation /DEF=(HINXTON)
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_170951(11) |
|
|
|
|
|
NM_170951 NCBI |
Caenorhabditis elegans Y105E8A.19 (Y105E8A.19) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000013508 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:14484947:14486651:-1 |
11/11 |
None |
SNAP00000013344 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:14485037:14506409:-1 |
11/11 |
None |
Y105E8A.19 ENSEMBL |
cdna:known chromosome:CEL140:I:14484792:14494880:-1 gene:Y105E8A.19 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:14484967-14486582(-) |
99.28 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
Y105E8A.19
|
|
173311 Entrez gene
|
|
Q8WQA5 EMBL-EBI
|
|
CE33722 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:267446_S_AT |
tRNA synthetase class I (W and Y) family protein |
at |
CANINE:1591677_AT |
similar to Tyrosyl-tRNA synthetase, cytoplasmic (Tyrosyl--tRNA ligase) (TyrRS) |
cfa |
CANINE_2:CFA.17812.1.S1_S_AT |
similar to Tyrosyl-tRNA synthetase, cytoplasmic (Tyrosyl--tRNA ligase) (TyrRS) |
cfa |
CANINE_2:CFA.19844.1.S1_AT |
similar to Tyrosyl-tRNA synthetase, cytoplasmic (Tyrosyl--tRNA ligase) (TyrRS) |
cfa |
CANINE_2:CFAAFFX.16411.1.S1_AT |
similar to Tyrosyl-tRNA synthetase, cytoplasmic (Tyrosyl--tRNA ligase) (TyrRS) |
cfa |
CANINE_2:CFAAFFX.16428.1.S1_AT |
similar to Tyrosyl-tRNA synthetase, cytoplasmic (Tyrosyl--tRNA ligase) (TyrRS) |
cfa |
CANINE_2:CFAAFFX.16428.1.S1_S_AT |
similar to Tyrosyl-tRNA synthetase, cytoplasmic (Tyrosyl--tRNA ligase) (TyrRS) |
cfa |
DROSOPHILA_2:1632234_AT |
Tyrosyl-tRNA synthetase |
dm |
DROSGENOME1:142649_AT |
Tyrosyl-tRNA synthetase |
dm |
CHICKEN:GGA.4637.1.S1_S_AT |
tyrosyl-tRNA synthetase |
gga |
CHICKEN:GGA.4637.2.S1_S_AT |
tyrosyl-tRNA synthetase |
gga |
HG-U133A_2:212048_S_AT |
tyrosyl-tRNA synthetase |
hs |
HG-FOCUS:212048_S_AT |
tyrosyl-tRNA synthetase |
hs |
HG-U133_PLUS_2:212048_S_AT |
tyrosyl-tRNA synthetase |
hs |
HG-U133A:212048_S_AT |
tyrosyl-tRNA synthetase |
hs |
HU35KSUBA:AA232121_R_AT |
tyrosyl-tRNA synthetase |
hs |
HU35KSUBA:AA232121_S_AT |
tyrosyl-tRNA synthetase |
hs |
HU35KSUBA:RC_AA257977_AT |
tyrosyl-tRNA synthetase |
hs |
HU35KSUBC:RC_AA102053_AT |
tyrosyl-tRNA synthetase |
hs |
HUGENEFL:U40714_AT |
tyrosyl-tRNA synthetase |
hs |
U133_X3P:HS.239307.1.A2_3P_A_AT |
tyrosyl-tRNA synthetase |
hs |
U133_X3P:HS.168020.0.A1_3P_AT |
tyrosyl-tRNA synthetase |
hs |
HG-U133_PLUS_2:238760_AT |
tyrosyl-tRNA synthetase |
hs |
HG-U133B:238760_AT |
tyrosyl-tRNA synthetase |
hs |
HG-U95AV2:38977_AT |
tyrosyl-tRNA synthetase |
hs |
HG-U95B:43172_AT |
tyrosyl-tRNA synthetase |
hs |
HG-U95D:71297_AT |
Tyrosyl-tRNA synthetase |
hs |
HG-U95E:72663_AT |
Tyrosyl-tRNA synthetase |
hs |
HG-U95E:84414_AT |
Tyrosyl-tRNA synthetase |
hs |
HU35KSUBC:RC_AA146671_AT |
Tyrosyl-tRNA synthetase |
hs |
HU35KSUBD:RC_R06129_AT |
Tyrosyl-tRNA synthetase |
hs |
MU11KSUBA:AA673272_S_AT |
tyrosyl-tRNA synthetase |
mm |
MU11KSUBB:MSA.16669.0_S_AT |
tyrosyl-tRNA synthetase |
mm |
MU11KSUBB:MSA.18695.0_S_AT |
tyrosyl-tRNA synthetase |
mm |
MG-U74AV2:93564_AT |
tyrosyl-tRNA synthetase |
mm |
MOE430A:1460638_AT |
tyrosyl-tRNA synthetase |
mm |
MOUSE430A_2:1460638_AT |
tyrosyl-tRNA synthetase |
mm |
MOUSE430_2:1460638_AT |
tyrosyl-tRNA synthetase |
mm |
MG-U74AV2:162093_AT |
Tyrosyl-tRNA synthetase, mRNA (cDNA clone MGC:37380 IMAGE:4976999) |
mm |
MU11KSUBA:AA492894_AT |
Tyrosyl-tRNA synthetase, mRNA (cDNA clone MGC:37380 IMAGE:4976999) |
mm |
MU19KSUBA:TC14996_AT |
Tyrosyl-tRNA synthetase, mRNA (cDNA clone MGC:37380 IMAGE:4976999) |
mm |
MU19KSUBA:TC14996_G_AT |
Tyrosyl-tRNA synthetase, mRNA (cDNA clone MGC:37380 IMAGE:4976999) |
mm |
MU19KSUBB:TC33433_AT |
Tyrosyl-tRNA synthetase, mRNA (cDNA clone MGC:37380 IMAGE:4976999) |
mm |
RG-U34C:RC_AI235277_AT |
tyrosyl-tRNA synthetase (predicted) |
rn |
RAE230A:1372009_AT |
tyrosyl-tRNA synthetase (predicted) |
rn |
RAT230_2:1372009_AT |
tyrosyl-tRNA synthetase (predicted) |
rn |
YEAST_2:1774768_AT |
Cytoplasmic tyrosyl-tRNA synthetase, class I aminoacyl-tRNA synthetase that aminoacylates tRNA(Tyr), required for cytoplasmic protein synthesis, interacts with positions 34 and 35 of the anticodon of tRNATyr |
Sc | |
|
|
|
|
|
6418 |
tRNA aminoacylation for protein translation |
inferred from electronic annotation |
QuickGO AmiGO |
6437 |
tyrosyl-tRNA aminoacylation |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4812 |
tRNA ligase activity |
inferred from electronic annotation |
QuickGO AmiGO |
4831 |
tyrosine-tRNA ligase activity |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAD21668 |
Hypothetical protein Y105E8A.19 [Caenorhabditis elegans] ref|NP_740947.2| Y105E8A.19 [Caenorhabditis elegans] dbj|BAC76736.1| tyrosyl-tRNA synthetase (cytoplasmic) [Caenorhabditis elegans] |
0.0 |
blast |
CAE72594 |
Hypothetical protein CBG19783 [Caenorhabditis briggsae] |
0.0 |
blast |
BAC76732.1 |
methionyl-tRNA synthetase (mitochondrial) [Caenorhabditis elegans] |
0.0 |
blast |
CAD21668 |
Hypothetical protein Y105E8A.19 [Caenorhabditis elegans] ref|NP_740947.2| Y105E8A.19 [Caenorhabditis elegans] dbj|BAC76736.1| tyrosyl-tRNA synthetase (cytoplasmic) [Caenorhabditis elegans] |
1.0E-102 |
blast |
CAG32285 |
hypothetical protein [Gallus gallus] ref|NP_001006314.1| tyrosyl-tRNA synthetase [Gallus gallus] |
2.0E-85 | |
|
|
|
|
|
Pfam |
IPR002305 EMBL-EBI |
Aminoacyl-tRNA synthetase, class Ib |
9.8E-56 |
Pfam |
IPR002305 EMBL-EBI |
Aminoacyl-tRNA synthetase, class Ib |
9.8E-56 |
GENEFINDER00000013508 |
1 |
280-302 | |
Sequence |
|
>C. ELEGANS:175997_S_AT
ctcaatggagcagctttgcacatccaacgtgctccggataatggtggtgacgtggaggtc
acaaactacaaacagttggagcaggaatttgtgattggaacgaagaatgagcagcagttt
ccacttcatccggctgatttgaagaacgcggtggttggggttattaatcgaagaaaaaaa
caaaaagcggaaaaattcgacttttcggtgtcaatttttgaatatcaaaaaattcagaaa
attttttcgacaaacctacaaaatacaacatgtagaattctgatgtttcctgtcaaactc
agatttaatttaaattcgacttttgaagcaaaattttggattaaaaaatccctattcgac
ggagttcgagccgatttcgccgaaaagccacgccagaagctcgtgacagatgcc
BLASTn GenBank NR |
|
|
|
|
|
|
CTCAATGGAGCAGCTTTGCACATCC |
427 |
227 |
397 |
Antisense |
GCAGCTTTGCACATCCAACGTGCTC |
237 |
313 |
406 |
Antisense |
CACATCCAACGTGCTCCGGATAATG |
563 |
195 |
415 |
Antisense |
ACGTGCTCCGGATAATGGTGGTGAC |
142 |
93 |
423 |
Antisense |
GGATAATGGTGGTGACGTGGAGGTC |
432 |
511 |
432 |
Antisense |
CGTGGAGGTCACAAACTACAAACAG |
450 |
245 |
447 |
Antisense |
TCATCCGGCTGATTTGAAGAACGCG |
204 |
619 |
522 |
Antisense |
AGTTCGAGCCGATTTCGCCGAAAAG |
434 |
63 |
759 |
Antisense |
TCGAGCCGATTTCGCCGAAAAGCCA |
358 |
601 |
762 |
Antisense |
AAGCCACGCCAGAAGCTCGTGACAG |
392 |
149 |
781 |
Antisense |
ACGCCAGAAGCTCGTGACAGATGCC |
106 |
91 |
786 |
Antisense | |
|
Affymetrix Proprietary Database |