|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
175825_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.19960
|
|
Exemplar sequence
|
|
3452402 NCBI
|
|
g3452402 /REP_DB=GenBank Identifier /GB=AF083648.1 /PROTEIN_GB=AAC32859.1 /CHR=X /FEA=Mapped Transcript /DEF=putative potassium channel subunit n2P17m2-3
|
This cluster is supported by a Mapped Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001029294(11), NM_001029296(11), NM_001029292(11), NM_001029293(11), NM_001029291(11), NM_001029295(11) |
|
|
|
|
|
NM_001029294 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029296 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029292 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029293 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029291 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
NM_001029295 NCBI |
Caenorhabditis elegans TWiK family of potassium channels family member (twk-17) (twk-17) mRNA, complete cds. |
11/11 |
None |
SNAP00000016789 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:7600307:7603348:-1 |
10/11 |
None |
C44E12.3d ENSEMBL |
cdna:known chromosome:CEL140:X:7599778:7606338:-1 gene:C44E12.3 |
11/11 |
A |
C44E12.3e ENSEMBL |
cdna:known chromosome:CEL140:X:7599810:7606338:-1 gene:C44E12.3 |
11/11 |
A |
C44E12.3f ENSEMBL |
cdna:known chromosome:CEL140:X:7600307:7607948:-1 gene:C44E12.3 |
11/11 |
None |
C44E12.3c ENSEMBL |
cdna:known chromosome:CEL140:X:7600307:7606338:-1 gene:C44E12.3 |
11/11 |
A |
C44E12.3a ENSEMBL |
cdna:known chromosome:CEL140:X:7600307:7604350:-1 gene:C44E12.3 |
11/11 |
A |
C44E12.3b ENSEMBL |
cdna:known chromosome:CEL140:X:7600307:7607948:-1 gene:C44E12.3 |
11/11 |
A | |
GENEFINDER00000016791 |
8/11 |
Cross Hyb Matching Probes |
None | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:7600853-7606337(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
C44E12.3
|
Functional Annotations |
|
|
|
|
|
blast |
AAM51532 |
Twik family of potassium channels protein 17, isoform d [Caenorhabditis elegans] ref|NP_001024465.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32862.1| putative potassium channel subunit n2P17m2-1 [Caenorhabditis elegans] |
0.0 |
blast |
AAM51531 |
Twik family of potassium channels protein 17, isoform c [Caenorhabditis elegans] ref|NP_001024464.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32858.1| putative potassium channel subunit n2P17m2-2 [Caenorhabditis elegans] |
0.0 |
blast |
AAP31441 |
Twik family of potassium channels protein 17, isoform e [Caenorhabditis elegans] ref|NP_001024466.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32859.1| putative potassium channel subunit n2P17m2-3 [Caenorhabditis elegans] |
0.0 |
blast |
AAW30673 |
Twik family of potassium channels protein 17, isoform f [Caenorhabditis elegans] ref|NP_001024467.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32854.1| putative potassium channel subunit n2P17m1-2 [Caenorhabditis elegans] |
0.0 |
blast |
AAM51530 |
Twik family of potassium channels protein 17, isoform b [Caenorhabditis elegans] ref|NP_001024463.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] gb|AAC32855.1| putative potassium channel subunit n2P17m1-1 [Caenorhabditis elegans] |
0.0 |
blast |
AAM51529 |
Twik family of potassium channels protein 17, isoform a [Caenorhabditis elegans] ref|NP_001024462.1| TWiK family of potassium channels family member (twk-17) [Caenorhabditis elegans] |
0.0 | |
|
NP_001024465.1 |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
NP_001024467.1 |
6 |
78-100,179-201,211-233,301-323,328-350,357-376 |
NP_001024463.1 |
6 |
78-100,179-201,211-233,301-323,328-350,357-376 |
NP_001024464.1 |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
NP_001024462.1 |
6 |
85-107,186-208,218-240,308-330,335-357,364-383 |
NP_001024466.1 |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
C44E12.3d |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
C44E12.3e |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
C44E12.3f |
6 |
78-100,179-201,211-233,301-323,328-350,357-376 |
C44E12.3c |
6 |
142-164,243-265,275-297,365-387,392-414,421-440 |
C44E12.3a |
6 |
85-107,186-208,218-240,308-330,335-357,364-383 |
C44E12.3b |
6 |
78-100,179-201,211-233,301-323,328-350,357-376 |
SNAP00000016789 |
5 |
88-110,125-147,176-198,203-225,232-251 | |
Sequence |
|
>C. ELEGANS:175825_S_AT
cgaaatgcgagtagtctggacgacgaagaatgtgaagatgaggaagatcgattacagttg
cccattgctagttatttcacgctaattattggatactgttgcgttggaagtttattattc
aatacgtttgaaaaaggacccgtatggtcattcattcacggcgtcttcttctcattcaat
accatcacaacaattggattgggaaatattcgagttcagcagcactactaccttgcactc
gcggtatcttatgtaattatcggtcttgctgtcatcactgcatcactggatctctgttcc
tctacactgaaacgaacatttaccaaacttcactactttggaagaaagattcgtggtgct
cgacgtggttttgcaaatatgagcgatgacatccgagaagcaatgcgaataattgctgcg
ttgaaaaagacaaggccatcgaaagatcg
BLASTn GenBank NR |
|
|
|
|
|
|
CGAAATGCGAGTAGTCTGGACGACG |
100 |
251 |
1045 |
Antisense |
GGAAGATCGATTACAGTTGCCCATT |
576 |
531 |
1086 |
Antisense |
GTTGCCCATTGCTAGTTATTTCACG |
584 |
439 |
1101 |
Antisense |
ATTTCACGCTAATTATTGGATACTG |
624 |
13 |
1118 |
Antisense |
GGATACTGTTGCGTTGGAAGTTTAT |
690 |
507 |
1135 |
Antisense |
CGTATGGTCATTCATTCACGGCGTC |
276 |
245 |
1185 |
Antisense |
TCTTCTTCTCATTCAATACCATCAC |
393 |
617 |
1208 |
Antisense |
ATTCGAGTTCAGCAGCACTACTACC |
236 |
7 |
1252 |
Antisense |
TGGTGCTCGACGTGGTTTTGCAAAT |
269 |
543 |
1398 |
Antisense |
GAGCGATGACATCCGAGAAGCAATG |
350 |
387 |
1425 |
Antisense |
AAAAGACAAGGCCATCGAAAGATCG |
576 |
131 |
1469 |
Antisense | |
|
GenBank | |