|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
175781_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.19983
|
|
Exemplar sequence
|
|
1778589 NCBI
|
|
g1778589 /REP_DB=GenBank Identifier /GB=U82935.1 /PROTEIN_GB=AAB40868.1 /CHR=X /FEA=Mapped Transcript /DEF=protein kinase C2 A isoform
|
This cluster is supported by a Mapped Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001029345(11), NM_001029347(11) |
|
|
|
|
|
NM_001029345 NCBI |
Caenorhabditis elegans Protein Kinase C family member (pkc-2) (pkc-2) mRNA, complete cds. |
11/11 |
None |
NM_001029347 NCBI |
Caenorhabditis elegans Protein Kinase C family member (pkc-2) (pkc-2) mRNA, complete cds. |
11/11 |
None |
SNAP00000040112 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:9385185:9385656:1 |
11/11 |
None |
E01H11.1a.2 ENSEMBL |
cdna:known chromosome:CEL140:X:9371060:9385965:1 gene:E01H11.1 |
11/11 |
A |
E01H11.1a.1 ENSEMBL |
cdna:known chromosome:CEL140:X:9371086:9386328:1 gene:E01H11.1 |
11/11 |
A |
E01H11.1c ENSEMBL |
cdna:known chromosome:CEL140:X:9376201:9385656:1 gene:E01H11.1 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:9371059-9385965(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
E01H11.1
|
Functional Annotations |
|
|
|
|
|
blast |
AAM51503 |
Protein kinase c protein 2, isoform a [Caenorhabditis elegans] ref|NP_001024516.1| Protein Kinase C family member (pkc-2) [Caenorhabditis elegans] |
0.0 |
blast |
AAB40868 |
protein kinase C2 A isoform [Caenorhabditis elegans] |
0.0 |
blast |
AAM51504 |
Protein kinase c protein 2, isoform b [Caenorhabditis elegans] ref|NP_001024517.1| Protein Kinase C family member (pkc-2) [Caenorhabditis elegans] sp|P90980|KPC2_CAEEL Protein kinase C-like 2 (PKC2) |
0.0 |
blast |
AAA68709 |
Protein kinase c protein 2, isoform c [Caenorhabditis elegans] ref|NP_001024518.1| Protein Kinase C family member (pkc-2) [Caenorhabditis elegans] |
0.0 |
blast |
T15903 |
protein kinase C homolog - Caenorhabditis elegans |
0.0 |
blast |
CAE69829 |
Hypothetical protein CBG16150 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
2.0E-68 |
hanks |
1.2.3 |
AGC group; AGC I Diacylglycerol-activated/phospholipid-dependent protein kinase C (PKC) family; DPKC53b |
1.0E-125 |
hanks |
1.2.3 |
AGC group; AGC I Diacylglycerol-activated/phospholipid-dependent protein kinase C (PKC) family; DPKC53b |
1.0E-126 | |
|
|
|
|
|
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.6E-37 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
2.0E-24 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
6.2E-24 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
3.0E-81 |
Pfam |
IPR000961 EMBL-EBI |
Protein kinase C-terminal domain |
2.2E-35 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.6E-37 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
2.0E-24 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
6.2E-24 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
3.0E-81 |
Pfam |
IPR000961 EMBL-EBI |
Protein kinase C-terminal domain |
2.7E-21 |
Pfam |
IPR000961 EMBL-EBI |
Protein kinase C-terminal domain |
7.5E-21 |
Pfam |
IPR000961 EMBL-EBI |
Protein kinase C-terminal domain |
1.8E-21 |
NP_001024518.1 |
3 |
588-610,824-843,848-870 |
E01H11.1c |
3 |
588-610,824-843,848-870 | |
Sequence |
|
>C. ELEGANS:175781_S_AT
cgccgatgatacttccaacttcgattcagagtttactcacgaggtccctaagcttactcc
gattgaccgtctattcctcatgaatctggatcaaactgaattcgaaggattctcttttgt
caacccagaatatgttcaag
BLASTn GenBank NR |
|
|
|
|
|
|
CGCCGATGATACTTCCAACTTCGAT |
455 |
257 |
1934 |
Antisense |
GATACTTCCAACTTCGATTCAGAGT |
686 |
423 |
1941 |
Antisense |
TCAGAGTTTACTCACGAGGTCCCTA |
405 |
621 |
1959 |
Antisense |
TACTCACGAGGTCCCTAAGCTTACT |
271 |
643 |
1967 |
Antisense |
TAAGCTTACTCCGATTGACCGTCTA |
101 |
635 |
1982 |
Antisense |
TTACTCCGATTGACCGTCTATTCCT |
414 |
681 |
1987 |
Antisense |
GACCGTCTATTCCTCATGAATCTGG |
196 |
383 |
1998 |
Antisense |
TCCTCATGAATCTGGATCAAACTGA |
687 |
581 |
2008 |
Antisense |
TTCGAAGGATTCTCTTTTGTCAACC |
369 |
693 |
2034 |
Antisense |
AGGATTCTCTTTTGTCAACCCAGAA |
360 |
57 |
2039 |
Antisense |
TTTGTCAACCCAGAATATGTTCAAG |
153 |
667 |
2049 |
Antisense | |
|
GenBank |