|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
175721_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.19956
|
|
Exemplar sequence
|
|
1518843 NCBI
|
|
g1518843 /REP_DB=GenBank Identifier /GB=U63744.1 /PROTEIN_GB=AAC47308.1 /CHR=X /FEA=Mapped Transcript /DEF=p21-activated kinase CePAK
|
This cluster is supported by a Mapped Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001029209(11), NM_001029207(11), NM_001029208(11) |
|
|
|
|
|
NM_001029209 NCBI |
Caenorhabditis elegans P21-Activated Kinase family member (pak-1) (pak-1) mRNA, complete cds. |
11/11 |
None |
NM_001029207 NCBI |
Caenorhabditis elegans P21-Activated Kinase family member (pak-1) (pak-1) mRNA, complete cds. |
11/11 |
None |
NM_001029208 NCBI |
Caenorhabditis elegans P21-Activated Kinase family member (pak-1) (pak-1) mRNA, complete cds. |
11/11 |
None |
C09B8.7e.3 ENSEMBL |
cdna:known chromosome:CEL140:X:6044266:6048568:-1 gene:C09B8.7 |
11/11 |
A |
C09B8.7e.2 ENSEMBL |
cdna:known chromosome:CEL140:X:6044267:6048568:-1 gene:C09B8.7 |
11/11 |
A |
C09B8.7e.1 ENSEMBL |
cdna:known chromosome:CEL140:X:6044275:6046119:-1 gene:C09B8.7 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:6044265-6048562(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
C09B8.7
|
Functional Annotations |
|
|
|
|
|
blast |
AAL65775 |
P21-activated kinase family protein 1, isoform b [Caenorhabditis elegans] ref|NP_001024378.1| P21-Activated Kinase family member (pak-1) [Caenorhabditis elegans] dbj|BAA11844.1| protein kinase [Caenorhabditis elegans] |
0.0 |
blast |
AAA68805 |
P21-activated kinase family protein 1, isoform a [Caenorhabditis elegans] ref|NP_001024377.1| P21-Activated Kinase family member (pak-1) [Caenorhabditis elegans] sp|Q17850|PAK1_CAEEL Serine/threonine-protein kinase pak-1 (p21-activated kinase 1) (PAK1) (CePAK) |
0.0 |
blast |
AAC47308 |
p21-activated kinase CePAK [Caenorhabditis elegans] |
0.0 |
blast |
AAO61438 |
P21-activated kinase family protein 1, isoform c [Caenorhabditis elegans] ref|NP_001024379.1| P21-Activated Kinase family member (pak-1) [Caenorhabditis elegans] |
0.0 |
blast |
AAA68805 |
P21-activated kinase family protein 1, isoform a [Caenorhabditis elegans] ref|NP_001024377.1| P21-Activated Kinase family member (pak-1) [Caenorhabditis elegans] sp|Q17850|PAK1_CAEEL Serine/threonine-protein kinase pak-1 (p21-activated kinase 1) (PAK1) (CePAK) |
7.0E-67 |
blast |
AAL65775 |
P21-activated kinase family protein 1, isoform b [Caenorhabditis elegans] ref|NP_001024378.1| P21-Activated Kinase family member (pak-1) [Caenorhabditis elegans] dbj|BAA11844.1| protein kinase [Caenorhabditis elegans] |
7.0E-67 |
blast |
AAO61440 |
P21-activated kinase family protein 1, isoform e [Caenorhabditis elegans] ref|NP_001024380.1| P21-Activated Kinase family member (pak-1) [Caenorhabditis elegans] |
7.0E-67 | |
|
|
|
|
|
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
1.0E-62 |
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
6.0E-63 |
hanks |
2.1.17 |
CaMK Group; CaMK I Regulated by Ca2+/CaM and close relatives; TWITCH |
7.0E-71 |
hanks |
2.1.17 |
CaMK Group; CaMK I Regulated by Ca2+/CaM and close relatives; TWITCH |
5.0E-71 |
hanks |
1.1.1 |
AGC group; AGC I Cyclic nucleotide regulated protein kinase (PKA & PKG); cAPKa |
4.0E-22 | |
|
|
|
|
|
scop |
a.1.1.Globins |
All alpha proteins; Globin-like; Globin-like; Globins |
8.0 |
scop |
a.1.1.Globins |
All alpha proteins; Globin-like; Globin-like; Globins |
7.59999990463257 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
3.8E-31 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.0E-93 |
Pfam |
IPR000095 EMBL-EBI |
PAK-box/P21-Rho-binding |
1.2E-29 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.0E-93 |
Pfam |
IPR000095 EMBL-EBI |
PAK-box/P21-Rho-binding |
1.2E-29 | |
Sequence |
|
>C. ELEGANS:175721_S_AT
atgttttctggaatcgatcacgagtaaaaattcaagccccttcattatttcacatcttcc
ccctctttatctcttctcgcaatgcacaatttggactatctcttttttcttgttgttgag
cgttcccaatcagacgacacacttcaattatttatgtaagttttttgtcttcactttgtc
ttcttttcattcggtttcttgcatttgtgtcgttcgaacggaaatctacagttaaccagc
tttgcccaaatttccctatttctttttcaagtgtctgtaggtgggaactattgaaactct
gttttcatgtggtttccaa
BLASTn GenBank NR |
|
|
|
|
|
|
ATGTTTTCTGGAATCGATCACGAGT |
681 |
47 |
1914 |
Antisense |
AATTCAAGCCCCTTCATTATTTCAC |
109 |
177 |
1942 |
Antisense |
TTTATCTCTTCTCGCAATGCACAAT |
333 |
673 |
1979 |
Antisense |
ATTTGGACTATCTCTTTTTTCTTGT |
124 |
19 |
2002 |
Antisense |
TTTTTCTTGTTGTTGAGCGTTCCCA |
540 |
675 |
2017 |
Antisense |
TTCCCAATCAGACGACACACTTCAA |
430 |
695 |
2036 |
Antisense |
TAAGTTTTTTGTCTTCACTTTGTCT |
624 |
631 |
2070 |
Antisense |
TCTTCTTTTCATTCGGTTTCTTGCA |
370 |
617 |
2092 |
Antisense |
TCTTGCATTTGTGTCGTTCGAACGG |
492 |
617 |
2110 |
Antisense |
TCTACAGTTAACCAGCTTTGCCCAA |
707 |
611 |
2138 |
Antisense |
AACTCTGTTTTCATGTGGTTTCCAA |
526 |
139 |
2208 |
Antisense | |
|
GenBank |