|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
175660_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.19830
|
|
Exemplar sequence
|
|
1698713 NCBI
|
|
g1698713 /REP_DB=GenBank Identifier /GB=U67967.1 /PROTEIN_GB=AAC47829.1 /CHR=3 /FEA=Mapped Transcript /DEF=PTL-1B protein
|
This cluster is supported by a Mapped Transcript. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001027407(11), NM_001027406(10) |
|
|
|
|
|
NM_001027407 NCBI |
Caenorhabditis elegans Protein with Tau-Like repeats family member (ptl-1) (ptl-1) mRNA, complete cds. |
11/11 |
None |
NM_001027406 NCBI |
Caenorhabditis elegans Protein with Tau-Like repeats family member (ptl-1) (ptl-1) mRNA, complete cds. |
10/11 |
None |
F42G9.9b.1 ENSEMBL |
cdna:known chromosome:CEL140:III:763805:771327:1 gene:F42G9.9 |
10/11 |
None |
F42G9.9c ENSEMBL |
cdna:known chromosome:CEL140:III:765190:771377:1 gene:F42G9.9 |
11/11 |
A | |
GENEFINDER00000038502 |
4/11 |
Cross Hyb Matching Probes |
None | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:765187-771377(+) |
85.71 |
100.0 |
| |
Public Domain and Genome References |
|
F42G9.9
|
Functional Annotations |
|
|
|
|
|
blast |
AAK70646 |
Protein with tau-like repeats protein 1, isoform b [Caenorhabditis elegans] ref|NP_001022577.1| Protein with Tau-Like repeats family member (ptl-1) [Caenorhabditis elegans] |
1.0E-169 |
blast |
AAA80687 |
TAU-1b |
1.0E-169 |
blast |
AAK70647 |
Protein with tau-like repeats protein 1, isoform c [Caenorhabditis elegans] ref|NP_001022578.1| Protein with Tau-Like repeats family member (ptl-1) [Caenorhabditis elegans] gb|AAC47829.1| PTL-1B protein [Caenorhabditis elegans] |
1.0E-151 |
blast |
AAK70645 |
Protein with tau-like repeats protein 1, isoform a [Caenorhabditis elegans] ref|NP_001022576.1| Protein with Tau-Like repeats family member (ptl-1) [Caenorhabditis elegans] gb|AAB97090.1| PTL-1A protein [Caenorhabditis elegans] |
1.0E-143 |
blast |
AAK70646 |
Protein with tau-like repeats protein 1, isoform b [Caenorhabditis elegans] ref|NP_001022577.1| Protein with Tau-Like repeats family member (ptl-1) [Caenorhabditis elegans] |
1.0E-142 |
blast |
AAK70645 |
Protein with tau-like repeats protein 1, isoform a [Caenorhabditis elegans] ref|NP_001022576.1| Protein with Tau-Like repeats family member (ptl-1) [Caenorhabditis elegans] gb|AAB97090.1| PTL-1A protein [Caenorhabditis elegans] |
1.0E-142 | |
|
|
|
|
|
Pfam |
IPR001084 EMBL-EBI |
Tubulin-binding Tau protein |
8.0E-4 |
Pfam |
IPR001084 EMBL-EBI |
Tubulin-binding Tau protein |
1.6E-9 |
Pfam |
IPR001084 EMBL-EBI |
Tubulin-binding Tau protein |
2.8E-4 |
Pfam |
IPR001084 EMBL-EBI |
Tubulin-binding Tau protein |
1.7E-8 | |
Sequence |
|
>C. ELEGANS:175660_AT
caatcgctgatgtataccgcgcttaataatatgctttcaaatatttgtgcaactattgaa
ttaatttttgaatatattaactgttcccagccgtagtttctatttgacttccctgagcat
gttgaatcgaagaattttatcccaaggtttcagcttttttatctatattttcattttttg
ctttacaatctgtct
BLASTn GenBank NR |
|
|
|
|
|
|
CAATCGCTGATGTATACCGCGCTTA |
594 |
181 |
1376 |
Antisense |
TGTATACCGCGCTTAATAATATGCT |
474 |
559 |
1386 |
Antisense |
TATGCTTTCAAATATTTGTGCAACT |
673 |
655 |
1405 |
Antisense |
GAATATATTAACTGTTCCCAGCCGT |
380 |
325 |
1445 |
Antisense |
TTCCCAGCCGTAGTTTCTATTTGAC |
441 |
695 |
1459 |
Antisense |
TTCTATTTGACTTCCCTGAGCATGT |
177 |
691 |
1473 |
Antisense |
GACTTCCCTGAGCATGTTGAATCGA |
368 |
371 |
1481 |
Antisense |
GAATCGAAGAATTTTATCCCAAGGT |
564 |
325 |
1499 |
Antisense |
TATCCCAAGGTTTCAGCTTTTTTAT |
402 |
657 |
1513 |
Antisense |
TCAGCTTTTTTATCTATATTTTCAT |
471 |
625 |
1525 |
Antisense |
TCATTTTTTGCTTTACAATCTGTCT |
55 |
619 |
1546 |
Antisense | |
|
GenBank |