|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
175565_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.20997
|
|
Exemplar sequence
|
|
CEXT00664 NCBI
|
|
CEXT00664 /REP_DB=TREMBL Accession /GB=M80127 /CHR=3 /FEA=Genomic Cluster /DEF=wEST00664 Mixed stage, Stratagene (cat. no. 937006) Caenorhabditis elegans cDNA clone CEMSH62 similar to Multicatalytic proteinase subunit C5, mRNA sequence.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_066405(11) |
|
|
|
|
|
NM_066405 NCBI |
Caenorhabditis elegans Proteasome Beta Subunit family member (pbs-6) (pbs-6) mRNA, complete cds. |
11/11 |
None |
SNAP00000031508 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:8243139:8244008:-1 |
11/11 |
None |
GENEFINDER00000031526 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:8243139:8244008:-1 |
11/11 |
None |
C02F5.9.1 ENSEMBL |
cdna:known chromosome:CEL140:III:8243035:8244010:-1 gene:C02F5.9 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:8243122-8243449(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
Proteasome component C5
|
|
pbs-6
|
|
C02F5.9
|
|
176161 Entrez gene
|
|
P34286 EMBL-EBI
|
|
CE26745 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:251337_AT |
20S proteasome beta subunit F1 (PBF1) |
at |
CANINE:1586828_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
cfa |
CANINE_2:CFAAFFX.7079.1.S1_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
cfa |
DROSOPHILA_2:1623288_AT |
Proteasome 26kD subunit |
dm |
DROSGENOME1:142705_AT |
Proteasome 26kD subunit |
dm |
CHICKEN:GGA.4653.2.S1_A_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
gga |
HG-U133A_2:200876_S_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U133_PLUS_2:200876_S_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U133A:200876_S_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-FOCUS:200876_S_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U95AV2:1447_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HC-G110:1447_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HUGENEFL:D00761_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
U133_X3P:G4506192_3P_A_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U133A_2:214288_S_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U133_PLUS_2:214288_S_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U133A:214288_S_AT |
proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U133A_2:214289_AT |
Proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U133_PLUS_2:214289_AT |
Proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
HG-U133A:214289_AT |
Proteasome (prosome, macropain) subunit, beta type, 1 |
hs |
MOE430A:1420052_X_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
mm |
MOUSE430A_2:1420052_X_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
mm |
MOUSE430_2:1420052_X_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
mm |
MOE430A:1448166_A_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
mm |
MOUSE430_2:1448166_A_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
mm |
MOUSE430A_2:1448166_A_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
mm |
MU11KSUBB:MSA.43193.0_F_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
mm |
MG-U74AV2:98113_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
mm |
MU11KSUBA:C81484_RC_S_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
MG-U74BV2:116776_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
MG-U74AV2:160875_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
MOE430A:1420053_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
MOUSE430A_2:1420053_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
MOUSE430_2:1420053_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
MG-U74AV2:161923_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
MU19KSUBB:TC27792_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
MU19KSUBB:TC34588_F_AT |
Proteasome (prosome, macropain) subunit, beta type 1, mRNA (cDNA clone MGC:5916 IMAGE:3584538) |
mm |
RG-U34A:RC_AA849722_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
rn |
RAE230A:1398812_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
rn |
RAT230_2:1398812_AT |
proteasome (prosome, macropain) subunit, beta type 1 |
rn |
YEAST_2:1773552_AT |
20S proteasome beta-type subunit |
Sc | |
|
|
|
|
|
6511 |
ubiquitin-dependent protein catabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5839 |
proteasome core complex (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4175 |
endopeptidase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAK71356 |
Proteasome beta subunit protein 6 [Caenorhabditis elegans] ref|NP_498806.1| Proteasome Beta Subunit family member (pbs-6) [Caenorhabditis elegans] gb|AAG50223.1| proteasome component C5 [Caenorhabditis elegans] sp|P34286|PSB1_CAEEL Proteasome subunit beta type 1 (Proteasome subunit beta 6) |
1.0E-145 |
blast |
CAE56933 |
Hypothetical protein CBG24778 [Caenorhabditis briggsae] |
1.0E-138 |
blast |
AAH58455 |
Proteasome (prosome, macropain) subunit, beta type 1 [Rattus norvegicus] |
1.0E-43 | |
|
|
|
|
|
Pfam |
IPR001353 EMBL-EBI |
Peptidase T1, 20S proteasome |
1.5E-42 | |
Sequence |
|
>C. ELEGANS:175565_S_AT
atcgagcgtcttggatactcagccagtggagccgctgaaccaatgatcattccattcttg
gattgtcaaatcgggcacgttacgctctctgaaggatatgagcgtccggaactcacattg
gacagagccatctcattgatgaaggattcgttccgtggtgctgctgagcgtgaaatctct
actggagacaaaattcacttggtcatcgctgaagccggaaagccagtcgtcgta
BLASTn GenBank NR |
|
|
|
|
|
|
ATCGAGCGTCTTGGATACTCAGCCA |
59 |
37 |
19 |
Antisense |
GATACTCAGCCAGTGGAGCCGCTGA |
500 |
423 |
32 |
Antisense |
GAGCCGCTGAACCAATGATCATTCC |
474 |
385 |
47 |
Antisense |
GATTGTCAAATCGGGCACGTTACGC |
252 |
427 |
79 |
Antisense |
GCACGTTACGCTCTCTGAAGGATAT |
144 |
315 |
93 |
Antisense |
ATGAGCGTCCGGAACTCACATTGGA |
120 |
45 |
116 |
Antisense |
CACATTGGACAGAGCCATCTCATTG |
463 |
195 |
132 |
Antisense |
GATGAAGGATTCGTTCCGTGGTGCT |
137 |
413 |
156 |
Antisense |
TTCCGTGGTGCTGCTGAGCGTGAAA |
111 |
699 |
169 |
Antisense |
CACTTGGTCATCGCTGAAGCCGGAA |
111 |
197 |
214 |
Antisense |
TGAAGCCGGAAAGCCAGTCGTCGTA |
297 |
573 |
228 |
Antisense | |
|
Affymetrix Proprietary Database | |