|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
175463_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.20858
|
|
Exemplar sequence
|
|
AU113761 NCBI
|
|
AU113761_rc /REP_DB=TREMBL Accession /GB=AU113761 /CHR=2 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk711d10 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001027170(11), NM_001027169(11), AY204195(11) |
|
|
|
|
|
NM_001027170 NCBI |
Caenorhabditis elegans Nuclear Hormone Receptor family member (nhr-109) (nhr-109) mRNA, complete cds. |
11/11 |
None |
NM_001027169 NCBI |
Caenorhabditis elegans Nuclear Hormone Receptor family member (nhr-109) (nhr-109) mRNA, complete cds. |
11/11 |
None |
AY204195 NCBI |
Caenorhabditis elegans clone yk711d10 nuclear receptor NHR-109 precursor RNA, partial cds. |
11/11 |
A |
SNAP00000005695 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:4433393:4435137:1 |
11/11 |
None |
GENEFINDER00000005705 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:4433393:4435137:1 |
11/11 |
None |
T12C9.5b ENSEMBL |
cdna:known chromosome:CEL140:II:4433382:4435159:1 gene:T12C9.5 |
11/11 |
A |
T12C9.5a ENSEMBL |
cdna:known chromosome:CEL140:II:4433394:4435137:1 gene:T12C9.5 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:4434807-4435087(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
T12C9.5
|
Functional Annotations |
|
|
|
|
|
blast |
AAR30202 |
Nuclear hormone receptor family protein 109, isoform b [Caenorhabditis elegans] ref|NP_001022341.1| Nuclear Hormone Receptor family member (nhr-109) [Caenorhabditis elegans] |
0.0 |
blast |
AAO39198 |
nuclear receptor NHR-109 [Caenorhabditis elegans] |
0.0 |
blast |
AAO39198 |
nuclear receptor NHR-109 [Caenorhabditis elegans] |
1.0E-179 |
blast |
AAR30202 |
Nuclear hormone receptor family protein 109, isoform b [Caenorhabditis elegans] ref|NP_001022341.1| Nuclear Hormone Receptor family member (nhr-109) [Caenorhabditis elegans] |
1.0E-179 |
blast |
AAR30202 |
Nuclear hormone receptor family protein 109, isoform b [Caenorhabditis elegans] ref|NP_001022341.1| Nuclear Hormone Receptor family member (nhr-109) [Caenorhabditis elegans] |
1.0E-178 |
blast |
AAK18974 |
Nuclear hormone receptor family protein 109, isoform a [Caenorhabditis elegans] ref|NP_001022340.1| Nuclear Hormone Receptor family member (nhr-109) [Caenorhabditis elegans] |
1.0E-176 | |
|
|
|
|
|
Pfam |
IPR000536 EMBL-EBI |
Ligand-binding domain of nuclear hormone receptor |
1.7E-16 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
2.1E-8 |
Pfam |
IPR000536 EMBL-EBI |
Ligand-binding domain of nuclear hormone receptor |
1.7E-16 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
1.2E-26 |
Pfam |
IPR000536 EMBL-EBI |
Ligand-binding domain of nuclear hormone receptor |
1.7E-16 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
4.5E-9 |
Pfam |
IPR000536 EMBL-EBI |
Ligand-binding domain of nuclear hormone receptor |
1.7E-16 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
6.4E-9 |
Pfam |
IPR000536 EMBL-EBI |
Ligand-binding domain of nuclear hormone receptor |
1.7E-16 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
2.1E-8 | |
Sequence |
|
>C. ELEGANS:175463_AT
atgaatcttcaagttgacatctatgaatttctcacactttttacacttctccactgggat
actggccttgttgagatcaccgatgaatgtctggaaattggcacaaaagtcaaagcagaa
gtattcaaggagctggatttctatttgacaaatgtgaagaaagtcgcagagccatcagtt
agaatagggacaattgtcaacttacttccagcagttcataaaagcgtacgga
BLASTn GenBank NR |
|
|
|
|
|
|
ATGAATCTTCAAGTTGACATCTATG |
7 |
45 |
21 |
Antisense |
GACATCTATGAATTTCTCACACTTT |
205 |
371 |
36 |
Antisense |
TTTTTACACTTCTCCACTGGGATAC |
366 |
613 |
58 |
Antisense |
TCCACTGGGATACTGGCCTTGTTGA |
416 |
587 |
70 |
Antisense |
TACTGGCCTTGTTGAGATCACCGAT |
542 |
645 |
80 |
Antisense |
AAGGAGCTGGATTTCTATTTGACAA |
122 |
161 |
147 |
Antisense |
GAAAGTCGCAGAGCCATCAGTTAGA |
261 |
361 |
179 |
Antisense |
GAGCCATCAGTTAGAATAGGGACAA |
75 |
385 |
189 |
Antisense |
GACAATTGTCAACTTACTTCCAGCA |
96 |
365 |
209 |
Antisense |
GTCAACTTACTTCCAGCAGTTCATA |
29 |
465 |
216 |
Antisense |
CCAGCAGTTCATAAAAGCGTACGGA |
231 |
273 |
228 |
Antisense | |
|
Affymetrix Proprietary Database |