|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
175425_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.20090
|
|
Exemplar sequence
|
|
AV200748 NCBI
|
|
AV200748_rc /REP_DB=TREMBL Accession /GB=AV200748 /CHR=1 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk579h3 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_182011(10), NM_058601(10), NM_058602(11) |
|
|
|
|
|
NM_182011 NCBI |
Caenorhabditis elegans Amino Acid Transporter family member (aat-5) (aat-5) mRNA, complete cds. |
10/11 |
None |
NM_058601 NCBI |
Caenorhabditis elegans Amino Acid Transporter family member (aat-5) (aat-5) mRNA, complete cds. |
10/11 |
None |
NM_058602 NCBI |
Caenorhabditis elegans Amino Acid Transporter family member (aat-5) (aat-5) mRNA, complete cds. |
11/11 |
None |
C55C2.5c ENSEMBL |
cdna:known chromosome:CEL140:I:2571783:2576021:-1 gene:C55C2.5 |
10/11 |
None |
C55C2.5a ENSEMBL |
cdna:known chromosome:CEL140:I:2571784:2576007:-1 gene:C55C2.5 |
10/11 |
A |
C55C2.5b ENSEMBL |
cdna:known chromosome:CEL140:I:2571789:2576007:-1 gene:C55C2.5 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:2571853-2572174(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
C55C2.5
|
Functional Annotations |
|
|
|
|
|
blast |
AAV58874 |
Amino acid transporter protein 5, isoform a [Caenorhabditis elegans] ref|NP_491002.2| Amino Acid Transporter family member (aat-5) [Caenorhabditis elegans] |
0.0 |
blast |
T15226 |
hypothetical protein C55C2.5 - Caenorhabditis elegans |
0.0 |
blast |
CAE60537 |
Hypothetical protein CBG04164 [Caenorhabditis briggsae] |
0.0 |
blast |
AAV58875 |
Amino acid transporter protein 5, isoform b [Caenorhabditis elegans] ref|NP_491003.2| Amino Acid Transporter family member (aat-5) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR004841 EMBL-EBI |
Amino acid permease-associated region |
1.9E-10 |
Pfam |
IPR004841 EMBL-EBI |
Amino acid permease-associated region |
1.9E-5 |
Pfam |
IPR004841 EMBL-EBI |
Amino acid permease-associated region |
7.4E-20 |
NP_871811.2 |
7 |
7-29,39-61,82-104,126-148,160-182,202-224,237-259 |
NP_491002.2 |
12 |
7-29,39-61,82-104,126-148,160-182,202-224,237-259,284-306,335-352,357-379,392-414,419-438 |
NP_491003.2 |
12 |
7-29,39-61,82-104,126-148,160-182,202-224,237-259,284-306,335-352,357-379,392-414,419-438 |
C55C2.5c |
7 |
7-29,39-61,82-104,126-148,160-182,202-224,237-259 |
C55C2.5a |
12 |
7-29,39-61,82-104,126-148,160-182,202-224,237-259,284-306,335-352,357-379,392-414,419-438 |
C55C2.5b |
12 |
7-29,39-61,82-104,126-148,160-182,202-224,237-259,284-306,335-352,357-379,392-414,419-438 | |
Sequence |
|
>C. ELEGANS:175425_AT
aaatgctgtagaatctccagtgtgccgtcatctcttgtggatcttatcagtgatgttcag
tagcttatcattgcttcttttttccggaatcattctcttccatatgggttaatctgttgt
ctacattgctcattattttcgttgttttcagccaatatattcatcttt
BLASTn GenBank NR |
|
|
|
|
|
|
AAATGCTGTAGAATCTCCAGTGTGC |
42 |
119 |
87 |
Antisense |
GATGTTCAGTAGCTTATCATTGCTT |
164 |
411 |
138 |
Antisense |
ATCATTGCTTCTTTTTTCCGGAATC |
659 |
29 |
153 |
Antisense |
GCTTCTTTTTTCCGGAATCATTCTC |
420 |
305 |
159 |
Antisense |
GAATCATTCTCTTCCATATGGGTTA |
45 |
329 |
173 |
Antisense |
TCCATATGGGTTAATCTGTTGTCTA |
540 |
591 |
185 |
Antisense |
TAATCTGTTGTCTACATTGCTCATT |
95 |
637 |
196 |
Antisense |
GTTGTCTACATTGCTCATTATTTTC |
462 |
437 |
202 |
Antisense |
ATTGCTCATTATTTTCGTTGTTTTC |
206 |
7 |
211 |
Antisense |
TTTTCGTTGTTTTCAGCCAATATAT |
17 |
677 |
222 |
Antisense |
GTTTTCAGCCAATATATTCATCTTT |
241 |
449 |
230 |
Antisense | |
|
Affymetrix Proprietary Database | |