|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
175368_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.22144
|
|
Exemplar sequence
|
|
AV185613 NCBI
|
|
AV185613_rc /REP_DB=TREMBL Accession /GB=AV185613 /CHR=X /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk681a5 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_077680(11) |
|
|
|
|
|
NM_077680 NCBI |
Caenorhabditis elegans F17E5.2 (F17E5.2) mRNA, complete cds. |
11/11 |
None |
F17E5.2 ENSEMBL |
cdna:known chromosome:CEL140:X:12394186:12399411:1 gene:F17E5.2 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:12399099-12399379(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ADP/ATP carrier protein
|
|
F17E5.2
|
|
181399 Entrez gene
|
|
Q19529 EMBL-EBI
|
|
CE37355 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:250623_AT |
mitochondrial substrate carrier family protein |
at |
CANINE_2:CFAAFFX.30755.1.S1_S_AT |
similar to solute carrier family 25, member 25 isoform a |
cfa |
DROSOPHILA_2:1629806_A_AT |
|
dm |
DROSGENOME1:152957_AT |
|
dm |
DROSGENOME1:148658_AT |
|
dm |
CHICKEN:GGAAFFX.26398.2.S1_S_AT |
similar to mitochondrial Ca2+-dependent solute carrier; solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 |
gga |
MG-U74AV2:98569_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MG-U74BV2:162537_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MOE430A:1424735_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MOUSE430A_2:1424735_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MOUSE430_2:1424735_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MOE430B:1454284_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MOUSE430_2:1454284_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MOE430B:1447856_X_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MOUSE430_2:1447856_X_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
mm |
MU19KSUBC:TC36285_AT |
Solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25, mRNA (cDNA clone MGC:47196 IMAGE:5368306) |
mm |
MU19KSUBC:TC37114_AT |
Solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25, mRNA (cDNA clone MGC:47196 IMAGE:5368306) |
mm |
RG-U34C:RC_AA817759_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
rn |
RAE230A:1371754_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
rn |
RAT230_2:1371754_AT |
solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 |
rn |
YEAST_2:1769358_AT |
Probable transporter, member of the Ca2+-binding subfamily of the mitochondrial carrier family, with two EF-hand motifs; Pet9p and Sal1p have an overlapping function critical for viability; polymorphic in different S. cerevisiae strains |
Sc | |
|
|
|
|
|
6810 |
transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5743 |
mitochondrial inner membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5488 |
binding |
inferred from electronic annotation |
QuickGO AmiGO |
5509 |
calcium ion binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA90761 |
Hypothetical protein F17E5.2 [Caenorhabditis elegans] ref|NP_510081.3| F17E5.2 [Caenorhabditis elegans] sp|Q19529|CMC3_CAEEL Probable calcium-binding mitochondrial carrier F17E5.2 |
0.0 |
blast |
T21074 |
hypothetical protein F17E5.2 - Caenorhabditis elegans |
0.0 |
blast |
CAE57255 |
Hypothetical protein CBG00135 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR001993 EMBL-EBI |
Mitochondrial substrate carrier |
3.3E-35 |
Pfam |
IPR001993 EMBL-EBI |
Mitochondrial substrate carrier |
2.3E-34 |
Pfam |
IPR001993 EMBL-EBI |
Mitochondrial substrate carrier |
4.1E-27 |
Pfam |
IPR002048 EMBL-EBI |
Calcium-binding EF-hand |
1.2E-4 |
Pfam |
IPR002048 EMBL-EBI |
Calcium-binding EF-hand |
3.3E-5 |
Pfam |
IPR002048 EMBL-EBI |
Calcium-binding EF-hand |
0.088 | |
Sequence |
|
>C. ELEGANS:175368_AT
gttattttttcaattgcatagttatttatctatttattagattttctgtgttttttttca
ctctttaattgtcattatttcattgcctttttctgtattttttgaaaccctggtgtcatt
ctcaatgtttcacctaccttttggcacttccactgtggtagtgcaacagctcttggtcag
tacagtagtccccgtaccattttattttcaaacagttactctcttctgtctctt
BLASTn GenBank NR |
|
|
|
|
|
|
GTTATTTTTTCAATTGCATAGTTAT |
11 |
449 |
18 |
Antisense |
TATTTCATTGCCTTTTTCTGTATTT |
187 |
663 |
93 |
Antisense |
TCTGTATTTTTTGAAACCCTGGTGT |
400 |
605 |
109 |
Antisense |
GAAACCCTGGTGTCATTCTCAATGT |
238 |
359 |
121 |
Antisense |
GTGTCATTCTCAATGTTTCACCTAC |
91 |
487 |
130 |
Antisense |
TCAATGTTTCACCTACCTTTTGGCA |
192 |
633 |
139 |
Antisense |
CTTTTGGCACTTCCACTGTGGTAGT |
21 |
223 |
155 |
Antisense |
TGTGGTAGTGCAACAGCTCTTGGTC |
239 |
555 |
171 |
Antisense |
GTGCAACAGCTCTTGGTCAGTACAG |
171 |
481 |
178 |
Antisense |
TCTTGGTCAGTACAGTAGTCCCCGT |
651 |
611 |
188 |
Antisense |
AAACAGTTACTCTCTTCTGTCTCTT |
72 |
127 |
227 |
Antisense | |
|
Affymetrix Proprietary Database |