|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
175203_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.21476
|
|
Exemplar sequence
|
|
AU116437 NCBI
|
|
AU116437_rc /REP_DB=TREMBL Accession /GB=AU116437 /CHR=4 /FEA=Genomic Cluster /DEF=Caenorhabditis elegans cDNA clone:yk744f6 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade B annotation. |
|
NM_069088 |
|
|
|
|
|
GENEFINDER00000041295 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:8682554:8686592:-1 |
|
None |
F08B4.5.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:8682471:8686593:-1 gene:F08B4.5 |
|
None |
SNAP00000041286 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:8682554:8687791:-1 |
|
None |
NM_069088 NCBI |
Caenorhabditis elegans F08B4.5 (F08B4.5) mRNA, complete cds. |
|
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:8682303-8682628(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
F08B4.5
|
|
177673 Entrez gene
|
|
Q19196 EMBL-EBI
|
|
CE29749 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFAAFFX.21914.1.S1_S_AT |
similar to DNA polymerase epsilon subunit 2 |
cfa |
DROSOPHILA_2:1630620_AT |
|
dm |
DROSGENOME1:154339_AT |
|
dm |
CHICKEN:GGAAFFX.12131.1.S1_S_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
gga |
HG-U133_PLUS_2:205909_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
HG-U133A:205909_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
HG-FOCUS:205909_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
HG-U133A_2:205909_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
HU35KSUBD:RC_AA448664_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
U133_X3P:G4505934_3P_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
HG-U95AV2:41085_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
HG-U95D:84336_AT |
Polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
HU35KSUBD:RC_AA351146_AT |
Polymerase (DNA directed), epsilon 2 (p59 subunit) |
hs |
MOUSE430_2:1431440_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
mm |
MOE430B:1431440_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
mm |
MG-U74AV2:101920_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
mm |
MOE430A:1427094_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
mm |
MOUSE430A_2:1427094_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
mm |
MOUSE430_2:1427094_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) |
mm |
MU19KSUBA:TC19142_AT |
Polymerase (DNA directed), epsilon 2 (p59 subunit), mRNA (cDNA clone MGC:70176 IMAGE:30147626) |
mm |
RG-U34C:RC_AI070935_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) (predicted) |
rn |
RAE230B:1393982_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) (predicted) |
rn |
RAT230_2:1393982_AT |
polymerase (DNA directed), epsilon 2 (p59 subunit) (predicted) |
rn |
RAE230B:1396484_AT |
Polymerase (DNA directed), epsilon 2 (p59 subunit) (predicted) |
rn |
RAT230_2:1396484_AT |
Polymerase (DNA directed), epsilon 2 (p59 subunit) (predicted) |
rn |
YEAST_2:1770645_AT |
Second largest subunit of DNA polymerase II (DNA polymerase epsilon), required for normal yeast chromosomal replication; expression peaks at the G1/S phase boundary; potential Cdc28p substrate |
Sc | |
|
|
|
|
|
6260 |
DNA replication |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO |
3887 |
DNA-directed DNA polymerase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAB37729 |
Hypothetical protein F08B4.5 [Caenorhabditis elegans] ref|NP_501489.2| F08B4.5 [Caenorhabditis elegans] sp|Q19196|DPOE2_CAEEL Putative DNA polymerase epsilon subunit B (DNA polymerase II subunit B) |
0.0 |
blast |
T29484 |
hypothetical protein F08B4.5 - Caenorhabditis elegans |
0.0 |
blast |
CAE72481 |
Hypothetical protein CBG19657 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR007185 EMBL-EBI |
DNA polymerase epsilon subunit B |
1.0E-86 |
Pfam |
IPR003604 EMBL-EBI |
Zn-finger, U1-like |
2.0E-28 |
Pfam |
IPR007185 EMBL-EBI |
DNA polymerase epsilon subunit B |
1.3E-84 |
Pfam |
IPR007185 EMBL-EBI |
DNA polymerase epsilon subunit B |
2.4E-81 | |
Sequence |
|
>C. ELEGANS:175203_S_AT
gatgattaagaattcatacccaattatatttccagctctaacatcaaaaatgtaatcata
ttcttcttccttttctgacatgcttcacaaatcaagcttacctattttaattatcaaatc
tccaattccattcccgtttttctttgatctgcaaaccatctcaatctcacaattttccat
tcgattttcatctaatttt
BLASTn GenBank NR |
|
|
|
|
|
|
GATGATTAAGAATTCATACCCAATT |
24 |
411 |
87 |
Antisense |
CATACCCAATTATATTTCCAGCTCT |
309 |
213 |
101 |
Antisense |
AATTATATTTCCAGCTCTAACATCA |
335 |
175 |
108 |
Antisense |
TTCCTTTTCTGACATGCTTCACAAA |
233 |
701 |
153 |
Antisense |
CTTCACAAATCAAGCTTACCTATTT |
83 |
221 |
169 |
Antisense |
CAAGCTTACCTATTTTAATTATCAA |
314 |
185 |
179 |
Antisense |
TTATCAAATCTCCAATTCCATTCCC |
370 |
679 |
197 |
Antisense |
TTCCCGTTTTTCTTTGATCTGCAAA |
283 |
699 |
217 |
Antisense |
GATCTGCAAACCATCTCAATCTCAC |
316 |
419 |
232 |
Antisense |
ATTTTCCATTCGATTTTCATCTAAT |
24 |
15 |
258 |
Antisense |
TTCCATTCGATTTTCATCTAATTTT |
64 |
701 |
261 |
Antisense | |
|
Affymetrix Proprietary Database |