|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
174911_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.21337
|
|
Exemplar sequence
|
|
CEK016FXR NCBI
|
|
CEK016FXR_rc /REP_DB=TREMBL Accession /GB=D27651 /CHR=4 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk16f10 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade B annotation. |
|
NM_069872 |
|
|
|
|
|
ZK617.1a.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:11972693:12010977:-1 gene:ZK617.1 |
|
A |
NM_069872 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-22) (unc-22) mRNA, complete cds. |
|
None |
ZK617.1a.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:11972678:12010977:-1 gene:ZK617.1 |
|
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:11972687-11973173(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ZK617.1
|
Functional Annotations |
|
|
|
|
|
blast |
CAA98081 |
Hypothetical protein ZK617.1a [Caenorhabditis elegans] emb|CAA98064.2| Hypothetical protein ZK617.1a [Caenorhabditis elegans] ref|NP_502273.2| UNCoordinated family member (unc-22) [Caenorhabditis elegans] |
0.0 |
blast |
CAA98082 |
Hypothetical protein ZK617.1b [Caenorhabditis elegans] emb|CAA98065.2| Hypothetical protein ZK617.1b [Caenorhabditis elegans] ref|NP_502274.2| UNCoordinated family member (unc-22) [Caenorhabditis elegans] |
0.0 |
blast |
CAA33463 |
twitchin [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
6.0E-63 |
hanks |
2.1.17 |
CaMK Group; CaMK I Regulated by Ca2+/CaM and close relatives; TWITCH |
1.0E-154 | |
|
|
|
|
|
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.0E-7 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.2E-13 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.0E-16 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.2E-23 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.2E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.3E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
9.7E-19 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
5.8E-16 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.4E-13 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
4.9E-21 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.4E-18 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.4E-13 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.4E-13 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.4E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
3.4E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.4E-18 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.8E-11 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.8E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
7.1E-18 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
6.7E-19 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.2E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.7E-21 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.1E-22 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
3.7E-19 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
6.3E-22 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.6E-12 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
5.9E-20 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.1E-15 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.8E-18 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.3E-19 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
4.6E-15 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
4.9E-78 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
5.2E-6 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.0027 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.3E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
5.7E-6 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
2.1E-5 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
6.6E-5 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.0034 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.0037 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.13 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.0069 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.0014 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.024 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
7.9E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.0020 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
5.0E-6 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.031 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
3.4E-7 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
4.6E-6 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
8.1E-9 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.5E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
2.1E-4 | |
Sequence |
|
>C. ELEGANS:174911_AT
ttcaattgtttctcatttctccatgatttctcttttgtttccatctttttcagtcagatt
ttcagtttgggaccctgaatctctctgatccactttccatgattaggtatcaattcttaa
tatttgctgattatgcttgaattcgggacaaattcttcataaggttgcaatttttatgtc
tatttcttgagtatttttccaatagctttagtttggtagactccacatatcctggtgttt
tcttttctcacgattttttccattgtatgcgttctgaaatttgacttgaaaattttctgc
ttcttgtagatgctcaaaaaacttgaaattctactgaaactgctcatcttctctaaaaac
tgtaaatctttcatctagtcagtctgaggtgtttttatttctctctattttctctgga
BLASTn GenBank NR |
|
|
|
|
|
|
TTCAATTGTTTCTCATTTCTCCATG |
516 |
685 |
48 |
Antisense |
CTCCATGATTTCTCTTTTGTTTCCA |
303 |
235 |
66 |
Antisense |
CAGTTTGGGACCCTGAATCTCTCTG |
592 |
203 |
110 |
Antisense |
TCTCTGATCCACTTTCCATGATTAG |
61 |
613 |
129 |
Antisense |
GGTAGACTCCACATATCCTGGTGTT |
183 |
505 |
262 |
Antisense |
ATCCTGGTGTTTTCTTTTCTCACGA |
447 |
39 |
276 |
Antisense |
TCTCACGATTTTTTCCATTGTATGC |
462 |
613 |
293 |
Antisense |
ATTTTCTGCTTCTTGTAGATGCTCA |
6 |
15 |
339 |
Antisense |
TACTGAAACTGCTCATCTTCTCTAA |
481 |
647 |
379 |
Antisense |
GTAAATCTTTCATCTAGTCAGTCTG |
613 |
461 |
409 |
Antisense |
TTTATTTCTCTCTATTTTCTCTGGA |
207 |
675 |
441 |
Antisense | |
|
Affymetrix Proprietary Database |