[Home] | [Total List]

[174633_at]

Description CEK040B9R_rc /REP_DB=TREMBL Accession /GB=D34057 /CHR=5 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk40b9 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 81      6grp_high1_10_10 > 19      4grp_highest_8_8 > 48      4grp_high_8_8 > 42      6grp_highest_nonorm > 03      6grp_total > 29      4grp_total > 53      6grp_highest_sub > Cu      6grp_cgc > 02      4grp_rule_based > L1      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 2259
1 2 3 4 range
A 3111.5
(3)
P 		2519.9
(1.3)
P 		1644.9
(-1.2)
P 		1002.3
(-3)
P 		2109
B 3153.8
(3)
P 		2587.3
(1.5)
P 		1695.9
(-0.9)
P 		919.8
(-3)
P 		2234
C 2968.4
(3)
P 		2670.4
(2.1)
P 		1643.9
(-0.8)
P 		894.7
(-3)
P 		2074
avr 3077.9
(3) 		2592.5
(1.6) 		1661.6
(-1) 		938.9
(-3) 		2139

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 2866
1 2 3 4 5 6 range
A 4575.7
(3)
P 		2900.4
(-0.5)
P 		1709.9
(-3)
P 		2051.1
(-2.3)
P 		3622.6
(1)
P 		2561.8
(-1.2)
P 		2866
B 3970.5
(3)
P 		3104.9
(0.3)
P 		2041.6
(-3)
P 		2910.9
(-0.3)
P 		2408.6
(-1.9)
P 		2444.1
(-1.7)
P 		1929
C 3839.5
(3)
P 		2780.7
(-0.5)
P 		2512.9
(-1.4)
P 		2011.4
(-3)
P 		3264.3
(1.1)
P 		2171.9
(-2.5)
P 		1828
avr 4128.6
(3) 		2928.7
(-0.5) 		2088.1
(-3) 		2324.5
(-2.3) 		3098.5
(-0) 		2392.6
(-2.1) 		2041
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 986
1 2 3 4 range
A 1132.9
(3)
P 		547
(-0.6)
P 		430
(-1.3)
P 		146.7
(-3)
P 		986
B 1005.7
(3)
P 		639
(0.3)
P 		393
(-1.5)
P 		196
(-3)
P 		810
C 982.6
(3)
P 		767.8
(1.5)
P 		572.9
(0)
P 		150.9
(-3)
P 		832
avr 1040.4
(3) 		651.3
(0.3) 		465.3
(-0.9) 		164.5
(-3) 		876

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1051
1 2 3 4 5 6 range
A 843.5
(0.9)
P 		1031.5
(2.5)
P 		372.4
(-3)
P 		520.2
(-1.8)
P 		1093.2
(3)
P 		623.7
(-0.9)
P 		721
B 1381.5
(3)
P 		1033.5
(0.6)
P 		495.8
(-3)
P 		771
(-1.1)
P 		978.6
(0.3)
P 		911.4
(-0.2)
P 		886
C 1423.1
(3)
P 		848.5
(-0.4)
P 		639.6
(-1.6)
P 		404.5
(-3)
P 		1056.3
(0.8)
P 		727.1
(-1.1)
P 		1019
avr 1216
(3) 		971.2
(0.9) 		502.6
(-3) 		565.2
(-2.5) 		1042.7
(1.5) 		754.1
(-0.9) 		713
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 174633_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.21987
Sequence Type Exemplar sequence
Representative Public ID CEK040B9R NCBI
Target Description CEK040B9R_rc /REP_DB=TREMBL Accession /GB=D34057 /CHR=5 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk40b9 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_071357(11), NM_001028800(11), NM_001028798(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_071357 NCBI Caenorhabditis elegans KETtiN (Drosophila actin-binding) homolog family member (ketn-1) (ketn-1) mRNA, complete cds. 11/11 A 
NM_001028800 NCBI Caenorhabditis elegans KETtiN (Drosophila actin-binding) homolog family member (ketn-1) (ketn-1) mRNA, complete cds. 11/11 None
NM_001028798 NCBI Caenorhabditis elegans KETtiN (Drosophila actin-binding) homolog family member (ketn-1) (ketn-1) mRNA, complete cds. 11/11 None
F54E2.3a ENSEMBL cdna:known chromosome:CEL140:V:2781527:2800854:-1 gene:F54E2.3 11/11 A 
F54E2.3d ENSEMBL cdna:known chromosome:CEL140:V:2781811:2800854:-1 gene:F54E2.3 11/11 None
F54E2.3b ENSEMBL cdna:known chromosome:CEL140:V:2781819:2799640:-1 gene:F54E2.3 11/11 A 
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
GENEFINDER00000004060 2/11 Cross Hyb Matching Probes None
Splice Variants
Entrez Total Refseq Isoforms Total Detected By This Probeset Refseq Probesets
178740 4 3 NM_001028798 174633_at (11), 179937_s_at (11)
NM_001028799 179937_s_at (11)
NM_001028800 174633_at (11)
NM_071357 174633_at (11), 179937_s_at (11)
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:2781790-2782171(-) 100.0 100.0
Public Domain and Genome References
Ensembl F54E2.3
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAC78200 Kettin (drosophila actin-binding) homolog protein 1, isoform a [Caenorhabditis elegans] ref|NP_503758.3| KETtiN (Drosophila actin-binding) homolog family member (ketn-1) [Caenorhabditis elegans] 0.0
blast AAM45363 Kettin (drosophila actin-binding) homolog protein 1, isoform c [Caenorhabditis elegans] ref|NP_001023970.1| KETtiN (Drosophila actin-binding) homolog family member (ketn-1) [Caenorhabditis elegans] 0.0
blast AAM45364 Kettin (drosophila actin-binding) homolog protein 1, isoform d [Caenorhabditis elegans] ref|NP_001023971.1| KETtiN (Drosophila actin-binding) homolog family member (ketn-1) [Caenorhabditis elegans] 0.0
blast AAK82895 Kettin (drosophila actin-binding) homolog protein 1, isoform b [Caenorhabditis elegans] ref|NP_001023969.1| KETtiN (Drosophila actin-binding) homolog family member (ketn-1) [Caenorhabditis elegans] 0.0
blast BAA90302.2 kettin [Caenorhabditis elegans] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 13.0
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 1.8E-5
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.7E-6
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.9E-5
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.016
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.5E-10
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.6E-8
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.4E-4
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.0E-13
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 5.3E-11
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.0E-12
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 5.9E-15
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 3.8E-9
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.3E-8
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.7E-7
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.0018
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.32
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.2
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.4E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 6.7E-6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.59
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7E-6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.8E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.095
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.016
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.045
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.027
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 7.8E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.2
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 7.5E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.2E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0070
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.031
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.021
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0013
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.0
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0019
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 13.0
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 1.8E-5
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.7E-6
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.9E-5
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.016
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.5E-10
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.6E-8
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.4E-4
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.0E-13
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 5.3E-11
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.0E-12
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 5.9E-15
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 3.8E-9
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.3E-8
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.7E-7
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.0018
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.32
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0029
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 6.7E-6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.59
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7E-6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.8E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.095
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.016
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.045
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.027
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 7.8E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.2
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 7.5E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.2E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0070
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.031
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.021
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0013
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.0
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0019
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 13.0
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 1.8E-5
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.7E-6
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.9E-5
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.016
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.5E-10
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.6E-8
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.4E-4
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.0E-13
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 5.3E-11
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 2.0E-12
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 5.9E-15
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 3.8E-9
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.3E-8
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 4.7E-7
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.0018
Pfam IPR010939 EMBL-EBI Protein of unknown function DUF1136 0.32
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.0E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0018
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0042
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.2
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.4E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 6.7E-6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.59
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7E-6
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 3.8E-8
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.095
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.016
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.045
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.027
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 7.8E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.2
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 4.3E-5
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 7.5E-7
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 2.2E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0070
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.031
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.021
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0013
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.7E-4
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 1.0
Pfam IPR007110 EMBL-EBI Immunoglobulin-like 0.0019
Sequence
Target Sequence 
>C. ELEGANS:174633_AT
actctttagttctagtcgtcttccagtgaatttatcaattttaaagtcaacatcttccac
cttaggaactgatagaaatgctgccctatcatttttcctaatcagaaaatttcgaaaata
attgctgcccttttgaaaattttctgaactctagaatatttgaatttctgaaaaattgct
gccttttctgattcactattctctgtaccaccctgacatgttgattttcgctctttttca
ctgccattttcttttcaaatttgctgactttttttgtatataagaccgtggtttaaaagt
ttctagtcgacgtcataactgcctgtcaattttttt

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
ACTCTTTAGTTCTAGTCGTCTTCCA 27 101 28 Antisense
GTCGTCTTCCAGTGAATTTATCAAT 484 473 42 Antisense
TAAAGTCAACATCTTCCACCTTAGG 515 569 69 Antisense
GAAATGCTGCCCTATCATTTTTCCT 455