|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
174211_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.21643
|
|
Exemplar sequence
|
|
C54214 NCBI
|
|
C54214_rc /REP_DB=TREMBL Accession /GB=C54214 /CHR=4 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk354d9 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_171352(11), NM_171353(11) |
|
|
|
|
|
NM_171352 NCBI |
Caenorhabditis elegans Novel Channel type/putative Nematode CAlcium channel family member (nca-1) (nca-1) mRNA, complete cds. |
11/11 |
A |
NM_171353 NCBI |
Caenorhabditis elegans Novel Channel type/putative Nematode CAlcium channel family member (nca-1) (nca-1) mRNA, complete cds. |
11/11 |
A |
SNAP00000030429 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:6157427:6158845:-1 |
11/11 |
None |
GENEFINDER00000030436 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:6156964:6179312:-1 |
11/11 |
None |
C11D2.6d ENSEMBL |
cdna:known chromosome:CEL140:IV:6157296:6173024:-1 gene:C11D2.6 |
11/11 |
A |
C11D2.6c ENSEMBL |
cdna:known chromosome:CEL140:IV:6157299:6171656:-1 gene:C11D2.6 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:6157352-6157827(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
C11D2.6
|
Functional Annotations |
|
|
|
|
|
blast |
AAU05590 |
Novel channel type/putative nematode calcium channel protein 1, isoform d [Caenorhabditis elegans] ref|NP_741413.2| Novel Channel type/putative Nematode CAlcium channel family member (nca-1) [Caenorhabditis elegans] |
0.0 |
blast |
AAS65871 |
four domain-type voltage-gated ion channel alpha-1 subunit [Caenorhabditis elegans] |
0.0 |
blast |
AAM81121 |
Novel channel type/putative nematode calcium channel protein 1, isoform c [Caenorhabditis elegans] ref|NP_741414.1| Novel Channel type/putative Nematode CAlcium channel family member (nca-1) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
7.8E-28 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
6.5E-34 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.8E-37 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
9.0E-30 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
7.8E-28 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
6.5E-34 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.8E-37 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
9.0E-30 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
7.8E-28 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
6.5E-34 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.8E-37 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
9.0E-30 |
NP_741413.2 |
20 |
149-171,186-208,229-248,343-365,429-451,466-488,553-575,624-646,924-946,973-995,1002-1021,1066-1088,1150-1169,1184-1206,1261-1283,1298-1320,1333-1352,1367-1384,1404-1426,1490-1512 |
NP_741414.1 |
21 |
138-160,180-199,214-236,257-276,371-393,503-525,540-562,627-649,698-720,1005-1027,1054-1076,1083-1102,1147-1169,1231-1250,1265-1287,1342-1364,1379-1401,1414-1433,1448-1465,1485-1507,1571-1593 |
C11D2.6d |
20 |
149-171,186-208,229-248,343-365,429-451,466-488,553-575,624-646,924-946,973-995,1002-1021,1066-1088,1150-1169,1184-1206,1261-1283,1298-1320,1333-1352,1367-1384,1404-1426,1490-1512 |
C11D2.6c |
21 |
138-160,180-199,214-236,257-276,371-393,503-525,540-562,627-649,698-720,1005-1027,1054-1076,1083-1102,1147-1169,1231-1250,1265-1287,1342-1364,1379-1401,1414-1433,1448-1465,1485-1507,1571-1593 |
GENEFINDER00000030436 |
20 |
155-177,192-214,235-254,349-371,478-500,515-537,602-624,673-695,939-961,988-1010,1017-1036,1081-1103,1165-1184,1199-1221,1276-1298,1313-1335,1348-1367,1382-1399,1419-1441,1505-1527 | |
Sequence |
|
>C. ELEGANS:174211_S_AT
tccagctaaacgtctatgatctacctgacgtagaagaacgtggagaagattctccatttt
ctcccaaaaacttgtctgatgattttaatggagagcattcaccattggtgataactccat
ccttgcctgtaccaccgacacatggaagccctcgaccacttatgccatgtgaaacgacaa
aagatattgaaaaatggtggaattcccttgttgatta
BLASTn GenBank NR |
|
|
|
|
|
|
TCCAGCTAAACGTCTATGATCTACC |
518 |
587 |
24 |
Antisense |
ACGTCTATGATCTACCTGACGTAGA |
428 |
91 |
33 |
Antisense |
GAGAAGATTCTCCATTTTCTCCCAA |
613 |
391 |
66 |
Antisense |
TTCTCCATTTTCTCCCAAAAACTTG |
567 |
687 |
73 |
Antisense |
TTCTCCCAAAAACTTGTCTGATGAT |
520 |
693 |
82 |
Antisense |
ATGGAGAGCATTCACCATTGGTGAT |
68 |
53 |
111 |
Antisense |
CATTGGTGATAACTCCATCCTTGCC |
178 |
217 |
126 |
Antisense |
GCCTGTACCACCGACACATGGAAGC |
337 |
283 |
148 |
Antisense |
CCTCGACCACTTATGCCATGTGAAA |
250 |
267 |
173 |
Antisense |
GACCACTTATGCCATGTGAAACGAC |
593 |
383 |
177 |
Antisense |
AATGGTGGAATTCCCTTGTTGATTA |
620 |
161 |
216 |
Antisense | |
|
Affymetrix Proprietary Database | |