[Home] | [Total List]

[174208_at] guanine nucleotide-binding protein beta subunit

Description C32185_rc /REP_DB=TREMBL Accession /GB=C32185 /CHR=2 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk325g7 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 61      6grp_high1_10_10 > 16      4grp_highest_8_8 > 42      4grp_high_8_8 > 49      6grp_highest_nonorm > 50      6grp_total > 16      4grp_total > 62      6grp_highest_sub > De      6grp_cgc > 13      6grp_high1_sub > De      6grp_cgc_sub > De      6grp_total_sub > Decrease      6grp_rule_based > S1      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 575
1 2 3 4 range
A 750.6
(3)
P 		182.5
(-3)
P 		431.2
(-0.4)
P 		230.5
(-2.5)
P 		568
B 695.6
(3)
P 		428.2
(-0.1)
P 		394.4
(-0.5)
P 		176
(-3)
P 		520
C 639.7
(3)
P 		571.9
(2.1)
P 		525.2
(1.4)
P 		203.9
(-3)
P 		436
avr 695.3
(3) 		394.2
(-0.7) 		450.3
(0) 		203.5
(-3) 		492

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 707
1 2 3 4 5 6 range
A 722.3
(3)
P 		453.8
(0.2)
P 		379.7
(-0.6)
P 		151.3
(-3)
P 		332.2
(-1.1)
P 		222.7
(-2.2)
P 		571
B 858.6
(3)
P 		658.9
(1.1)
P 		219.3
(-2.9)
P 		293.7
(-2.3)
P 		213
(-3)
P 		236.5
(-2.8)
P 		646
C 782.5
(3)
P 		632.8
(1.4)
P 		245.9
(-2.6)
P 		203.4
(-3)
P 		212.9
(-2.9)
P 		233
(-2.7)
P 		579
avr 787.8
(3) 		581.8
(0.8) 		281.6
(-2.3) 		216.1
(-3) 		252.7
(-2.6) 		230.7
(-2.8) 		572
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 240
1 2 3 4 range
A 273.3
(3)
P 		39.6
(-2.9)
P 		112.7
(-1)
P 		33.7
(-3)
P 		240
B 221.8
(3)
P 		105.7
(-0.8)
P 		91.4
(-1.2)
P 		37.5
(-3)
P 		184
C 211.7
(3)
P 		164.4
(1.4)
P 		183
(2)
P 		34.4
(-3)
P 		177
avr 235.6
(3) 		103.2
(-1) 		129
(-0.2) 		35.2
(-3) 		200

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 260
1 2 3 4 5 6 range
A 133.1
(1.6)
P 		161.4
(3)
P 		82.7
(-0.8)
P 		38.4
(-3)
P 		100.3
(0)
P 		54.2
(-2.2)
P 		123
B 298.8
(3)
P 		219.3
(1.1)
P 		53.3
(-3)
P 		77.8
(-2.4)
P 		86.5
(-2.2)
P 		88.2
(-2.1)
P 		246
C 290
(3)
P 		193.1
(0.7)
P 		62.6
(-2.5)
P 		40.9
(-3)
P 		68.9
(-2.3)
P 		78
(-2.1)
P 		249
avr 240.6
(3) 		191.3
(1.4) 		66.2
(-2.6) 		52.4
(-3) 		85.2
(-2) 		73.5
(-2.3) 		188
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 174208_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.20598
Sequence Type Exemplar sequence
Representative Public ID C32185 NCBI
Target Description C32185_rc /REP_DB=TREMBL Accession /GB=C32185 /CHR=2 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk325g7 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Genomic Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_064107(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_064107 NCBI Caenorhabditis elegans G Protein, Beta subunit family member (gpb-1) (gpb-1) mRNA, complete cds. 11/11 A 
F13D12.7.1 ENSEMBL cdna:known chromosome:CEL140:II:11742720:11748508:-1 gene:F13D12.7 11/11 A 
F13D12.7.2 ENSEMBL cdna:known chromosome:CEL140:II:11742720:11747716:-1 gene:F13D12.7 11/11 A 
F13D12.7.3 ENSEMBL cdna:known chromosome:CEL140:II:11742722:11747723:-1 gene:F13D12.7 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:11743413-11743724(-) 100.0 100.0
Public Domain and Genome References
Gene Title guanine nucleotide-binding protein beta subunit
Gene Symbol gpb-1
Ensembl F13D12.7
Entrez Gene 174803 Entrez gene
SwissProt P17343 EMBL-EBI
WormBase CE02186 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:253204_AT guanine nucleotide-binding protein beta subunit (GB1) / GTP-binding protein beta subunit (AGB1) / transducin at
CANINE:1601476_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 cfa
CANINE:1583278_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 cfa
CANINE_2:CFA.17905.1.S1_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 cfa
CANINE_2:CFA.17905.1.S1_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 cfa
CANINE_2:CFA.3773.1.A1_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 cfa
CANINE:1584439_AT Rod transducin cfa
CANINE_2:CFA.3773.2.A1_AT Rod transducin cfa
CANINE_2:CFA.3773.2.A1_A_AT Rod transducin cfa
CANINE:1601181_S_AT Rod transducin cfa
DROSOPHILA_2:1627398_A_AT G protein subunit 13F dm
DROSGENOME1:154331_AT G protein subunit 13F dm
CHICKEN:GGA.8857.1.S1_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 gga
CHICKEN:GGAAFFX.11922.1.S1_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 gga
CHICKEN:GGAAFFX.11922.2.A1_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 gga
HG-U133_PLUS_2:200744_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133A_2:200744_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133A:200744_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133_PLUS_2:200745_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133A_2:200745_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-FOCUS:200745_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133A:200745_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133_PLUS_2:200746_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133A:200746_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133A_2:200746_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U95AV2:33341_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HU35KSUBA:AA120807_F_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HU35KSUBC:RC_AA121445_F_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HU35KSUBD:RC_AA416986_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HUGENEFL:X04526_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HUGENEFL:M36430_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
U133_X3P:G11321584_3P_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
U133_X3P:HS.215595.0.A2_3P_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
U133_X3P:HS.215595.0.A1_3P_S_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U95C:58600_AT guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
U133_X3P:HS2.407467.1.S1_3P_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
U133_X3P:HS2.382645.1.S1_3P_X_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
U133_X3P:1570248_3P_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133_PLUS_2:1570108_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133_PLUS_2:1570248_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133_PLUS_2:1570249_X_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133_PLUS_2:237371_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133B:237371_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133_PLUS_2:241865_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U133B:241865_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U95C:49887_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U95D:88737_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U95D:89256_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
HG-U95D:91352_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
U133_X3P:HS.133538.0.A1_3P_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
U133_X3P:HS.199596.0.A1_3P_AT Guanine nucleotide binding protein (G protein), beta polypeptide 1 hs
MOUSE430A_2:1425908_AT guanine nucleotide binding protein, beta 1 mm
MOUSE430_2:1425908_AT guanine nucleotide binding protein, beta 1 mm
MOE430A:1425908_AT guanine nucleotide binding protein, beta 1 mm
MU11KSUBA:U29055_F_AT guanine nucleotide binding protein, beta 1 mm
MU11KSUBB:MSA.3240.0_F_AT guanine nucleotide binding protein, beta 1 mm
MG-U74AV2:94853_AT guanine nucleotide binding protein, beta 1 mm
MG-U74AV2:97458_AT guanine nucleotide binding protein, beta 1 mm
MOE430A:1454696_AT guanine nucleotide binding protein, beta 1 mm
MOUSE430A_2:1454696_AT guanine nucleotide binding protein, beta 1 mm
MOUSE430_2:1454696_AT guanine nucleotide binding protein, beta 1 mm
MOE430A:1417432_A_AT guanine nucleotide binding protein, beta 1 mm
MOUSE430A_2:1417432_A_AT guanine nucleotide binding protein, beta 1 mm
MOUSE430_2:1417432_A_AT guanine nucleotide binding protein, beta 1 mm
MG-U74AV2:94854_G_AT Guanine nucleotide binding protein, beta 1, mRNA (cDNA clone MGC:11501 IMAGE:3964965) mm
MU19KSUBB:TC28855_AT Guanine nucleotide binding protein, beta 1, mRNA (cDNA clone MGC:11501 IMAGE:3964965) mm
MU19KSUBB:TC33264_AT Guanine nucleotide binding protein, beta 1, mRNA (cDNA clone MGC:11501 IMAGE:3964965) mm
RN-U34:RC_AI230404_S_AT guanine nucleotide binding protein, beta 1 rn
RG-U34C:RC_AI230404_S_AT guanine nucleotide binding protein, beta 1 rn
RN-U34:RC_AI227660_S_AT guanine nucleotide binding protein, beta 1 rn
RG-U34C:RC_AI227660_S_AT guanine nucleotide binding protein, beta 1 rn
RN-U34:AF022083_S_AT guanine nucleotide binding protein, beta 1 rn
RG-U34A:AF022083_S_AT guanine nucleotide binding protein, beta 1 rn
RN-U34:U88324_AT guanine nucleotide binding protein, beta 1 rn
RG-U34A:U88324_AT guanine nucleotide binding protein, beta 1 rn
RN-U34:U88324_G_AT guanine nucleotide binding protein, beta 1 rn
RG-U34A:U88324_G_AT guanine nucleotide binding protein, beta 1 rn
RAE230A:1367731_AT guanine nucleotide binding protein, beta 1 rn
RAT230_2:1367731_AT guanine nucleotide binding protein, beta 1 rn
RAE230A:1367732_AT guanine nucleotide binding protein, beta 1 rn
RAT230_2:1367732_AT guanine nucleotide binding protein, beta 1 rn
RAE230A:1375705_AT Guanine nucleotide binding protein, beta 1 rn
RAT230_2:1375705_AT Guanine nucleotide binding protein, beta 1 rn
RAE230B:1382982_AT Guanine nucleotide binding protein, beta 1 rn
RAT230_2:1382982_AT Guanine nucleotide binding protein, beta 1 rn
RG-U34B:RC_AI008284_S_AT Guanine nucleotide binding protein, beta 1 rn
RG-U34C:RC_AI073159_AT Guanine nucleotide binding protein, beta 1 rn
RG-U34C:RC_AI103622_AT Guanine nucleotide binding protein, beta 1 rn
RG-U34C:RC_AI230669_AT Guanine nucleotide binding protein, beta 1 rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
7186 G-protein coupled receptor protein signaling pathway inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5834 heterotrimeric G-protein complex inferred from electronic annotation QuickGO AmiGO
5834 heterotrimeric G-protein complex inferred from sequence similarity QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
4871 signal transducer activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA88948 Hypothetical protein F13D12.7 [Caenorhabditis elegans] ref|NP_496508.1| G Protein, Beta subunit family member (gpb-1) [Caenorhabditis elegans] gb|AAW02908.1| gpb-1 [Caenorhabditis briggsae] gb|AAK55963.1| heterotrimeric G protein beta subunit 1 [Caenorhabditis elegans] sp|P17343|GBB1_CAEEL Guanine nucleotide-binding protein beta subunit 1 sp|Q61ZF6|GBB1_CAEBR Guanine nucleotide-binding protein beta subunit 1 emb|CAE59700.1| Hypothetical protein CBG03131 [Caenorhabditis briggsae] 0.0
blast CAA35532 G-protein [Caenorhabditis elegans] 0.0
blast AAU12180 G protein beta 1 subunit [Litopenaeus vannamei] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR001680 EMBL-EBI G-protein beta WD-40 repeat 4.6E-8
Pfam IPR001680 EMBL-EBI G-protein beta WD-40 repeat 6.5E-6
Pfam IPR001680 EMBL-EBI G-protein beta WD-40 repeat 2.4E-8
Pfam IPR001680 EMBL-EBI G-protein beta WD-40 repeat 2.7E-9
Pfam IPR001680 EMBL-EBI G-protein beta WD-40 repeat 7.0E-13
Pfam IPR001680 EMBL-EBI G-protein beta WD-40 repeat 1.7E-4
Pfam IPR001680 EMBL-EBI G-protein beta WD-40 repeat 7.9E-7
Sequence
Target Sequence 
>C. ELEGANS:174208_AT
tcttctcatcgctttttgttcggtactttctagtctctcttcaatcgccctccccatatt
actttccttgacgtttgttcgaattttctcatcaattttttttactatgtgaaaattatt
attatagcaattctcaactctctctctctcatttatttttatttcacattttctgtgtct
ccccgccccccgcgaagcttaatctttcttcctctttcaccactcactttagtcacagac

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
TCTTCTCATCGCTTTTTGTTCGGTA 657 615 52 Antisense
TTTGTTCGGTACTTTCTAGTCTCTC 539 667 66 Antisense
CCCATATTACTTTCCTTGACGTTTG 229 243 104 Antisense
TACTTTCCTTGACGTTTGTTCGAAT 412 641 111 Antisense
GACGTTTGTTCGAATTTTCTCATCA 678 377 121 Antisense
CATCAATTTTTTTTACTATGTGAAA 180 213 141 Antisense
TTATAGCAATTCTCAACTCTCTCTC 18 681 173 Antisense
TATTTCACATTTTCTGTGTCTCCCC 65 663 211 Antisense
CCCGCGAAGCTTAATCTTTCTTCCT 195 261 240 Antisense
GAAGCTTAATCTTTCTTCCTCTTTC 559 341 245 Antisense
TTCACCACTCACTTTAGTCACAGAC 248 685 267 Antisense
Sequence Source Affymetrix Proprietary Database