|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
174166_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.20528
|
|
Exemplar sequence
|
|
C38649 NCBI
|
|
C38649_rc /REP_DB=TREMBL Accession /GB=C38649 /CHR=2 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk496c7 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063758(11), NM_001027360(11), NM_001027362(11), NM_001027361(11) |
|
|
|
|
|
NM_063758 NCBI |
Caenorhabditis elegans gaLECtin family member (lec-3) (lec-3) mRNA, complete cds. |
11/11 |
A |
NM_001027360 NCBI |
Caenorhabditis elegans gaLECtin family member (lec-3) (lec-3) mRNA, complete cds. |
11/11 |
None |
NM_001027362 NCBI |
Caenorhabditis elegans gaLECtin family member (lec-3) (lec-3) mRNA, complete cds. |
11/11 |
None |
NM_001027361 NCBI |
Caenorhabditis elegans gaLECtin family member (lec-3) (lec-3) mRNA, complete cds. |
11/11 |
None |
ZK892.1a ENSEMBL |
cdna:known chromosome:CEL140:II:9991280:10000248:1 gene:ZK892.1 |
11/11 |
A |
ZK892.1b ENSEMBL |
cdna:known chromosome:CEL140:II:9991320:10000244:1 gene:ZK892.1 |
11/11 |
A |
ZK892.1d ENSEMBL |
cdna:known chromosome:CEL140:II:9993531:10000256:1 gene:ZK892.1 |
11/11 |
A |
ZK892.1c ENSEMBL |
cdna:known chromosome:CEL140:II:9993845:10000248:1 gene:ZK892.1 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:9999892-10000178(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ZK892.1
|
Functional Annotations |
|
|
|
|
|
blast |
CAD57721 |
Hypothetical protein ZK892.1d [Caenorhabditis elegans] ref|NP_001022533.1| gaLECtin family member (lec-3) [Caenorhabditis elegans] |
0.0 |
blast |
CAA88570 |
Hypothetical protein ZK892.1a [Caenorhabditis elegans] ref|NP_496159.1| gaLECtin family member (lec-3) [Caenorhabditis elegans] sp|Q09581|LEC3_CAEEL 32 kDa beta-galactoside-binding lectin lec-3 (32 kDa GBP) dbj|BAB11969.1| galectin LEC-3 [Caenorhabditis elegans] |
1.0E-174 |
blast |
CAD57721 |
Hypothetical protein ZK892.1d [Caenorhabditis elegans] ref|NP_001022533.1| gaLECtin family member (lec-3) [Caenorhabditis elegans] |
1.0E-167 |
blast |
CAA88570 |
Hypothetical protein ZK892.1a [Caenorhabditis elegans] ref|NP_496159.1| gaLECtin family member (lec-3) [Caenorhabditis elegans] sp|Q09581|LEC3_CAEEL 32 kDa beta-galactoside-binding lectin lec-3 (32 kDa GBP) dbj|BAB11969.1| galectin LEC-3 [Caenorhabditis elegans] |
1.0E-167 |
blast |
CAC42392 |
Hypothetical protein ZK892.1b [Caenorhabditis elegans] ref|NP_001022531.1| gaLECtin family member (lec-3) [Caenorhabditis elegans] |
1.0E-166 | |
|
|
|
|
|
Pfam |
IPR001079 EMBL-EBI |
Galectin, galactose-binding lectin |
5.6E-32 |
Pfam |
IPR001079 EMBL-EBI |
Galectin, galactose-binding lectin |
4.2E-46 |
Pfam |
IPR001079 EMBL-EBI |
Galectin, galactose-binding lectin |
1.1E-50 |
Pfam |
IPR001079 EMBL-EBI |
Galectin, galactose-binding lectin |
5.6E-32 |
Pfam |
IPR001079 EMBL-EBI |
Galectin, galactose-binding lectin |
1.3E-15 |
Pfam |
IPR001079 EMBL-EBI |
Galectin, galactose-binding lectin |
6.3E-29 | |
Sequence |
|
>C. ELEGANS:174166_AT
actcatccagccactcatatagttcaccacgtccctagtttctttctatctctgatatat
ttgaaattcgccccaaaatcatcccttcacaatccaatatctgtcactttctccacgtct
ccatggtttctttttttttggttttttcctgaattttcaaaattcagtatctacgttttt
gtcccccaccacccgatttttcaattcatattctgcttttcca
BLASTn GenBank NR |
|
|
|
|
|
|
ACTCATCCAGCCACTCATATAGTTC |
379 |
101 |
16 |
Antisense |
TCCAGCCACTCATATAGTTCACCAC |
616 |
589 |
21 |
Antisense |
CCCTAGTTTCTTTCTATCTCTGATA |
507 |
259 |
48 |
Antisense |
AGTTTCTTTCTATCTCTGATATATT |
547 |
63 |
52 |
Antisense |
CTGATATATTTGAAATTCGCCCCAA |
331 |
239 |
67 |
Antisense |
TTTGAAATTCGCCCCAAAATCATCC |
395 |
665 |
75 |
Antisense |
TCATCCCTTCACAATCCAATATCTG |
27 |
623 |
94 |
Antisense |
ATCCCTTCACAATCCAATATCTGTC |
698 |
37 |
96 |
Antisense |
AATCCAATATCTGTCACTTTCTCCA |
452 |
167 |
106 |
Antisense |
TTCAAAATTCAGTATCTACGTTTTT |
587 |
683 |
171 |
Antisense |
TTTCAATTCATATTCTGCTTTTCCA |
537 |
673 |
214 |
Antisense | |
|
Affymetrix Proprietary Database |