|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
174164_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.21123
|
|
Exemplar sequence
|
|
C38983 NCBI
|
|
C38983_rc /REP_DB=TREMBL Accession /GB=C38983 /CHR=3 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk504a1 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_066976(11) |
|
|
|
|
|
NM_066976 NCBI |
Caenorhabditis elegans K01G5.9 (K01G5.9) mRNA, complete cds. |
11/11 |
A |
SNAP00000005062 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:10759865:10762683:1 |
10/11 |
None |
GENEFINDER00000005070 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:10761343:10776804:1 |
9/11 |
None |
K01G5.9.2 ENSEMBL |
cdna:known chromosome:CEL140:III:10759238:10762875:1 gene:K01G5.9 |
11/11 |
A |
K01G5.9.1 ENSEMBL |
cdna:known chromosome:CEL140:III:10759262:10762875:1 gene:K01G5.9 |
11/11 |
A |
K01G5.9.3 ENSEMBL |
cdna:known chromosome:CEL140:III:10759546:10762875:1 gene:K01G5.9 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:10762519-10762805(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
K01G5.9
|
|
176508 Entrez gene
|
|
Q9XTB8 EMBL-EBI
|
|
CE33132 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:16289_AT |
asparaginase 2 family protein |
at |
ATH1-121501:255684_AT |
asparaginase 2 family protein |
at |
CANINE:1605716_AT |
similar to Threonine aspartase 1 (Taspase 1) |
cfa |
CANINE_2:CFAAFFX.9349.1.S1_AT |
similar to Threonine aspartase 1 (Taspase 1) |
cfa |
DROSOPHILA_2:1633766_AT |
|
dm |
DROSGENOME1:153532_AT |
|
dm |
CHICKEN:GGA.14160.1.S1_S_AT |
taspase, threonine aspartase, 1 |
gga |
CHICKEN:GGAAFFX.5720.1.S1_S_AT |
taspase, threonine aspartase, 1 |
gga |
HG-U133_PLUS_2:233719_S_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U133B:233719_S_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U133_PLUS_2:219443_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U133A:219443_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U133A_2:219443_AT |
taspase, threonine aspartase, 1 |
hs |
HU35KSUBB:RC_H19673_AT |
taspase, threonine aspartase, 1 |
hs |
HU35KSUBC:RC_AA261819_AT |
taspase, threonine aspartase, 1 |
hs |
U133_X3P:G8923201_3P_AT |
taspase, threonine aspartase, 1 |
hs |
U133_X3P:HS.306525.0.S1_3P_S_AT |
taspase, threonine aspartase, 1 |
hs |
U133_X3P:HS.306525.0.S1_3P_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U95B:47731_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U95B:48312_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U95C:57514_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U95C:57518_G_AT |
taspase, threonine aspartase, 1 |
hs |
HG-U95D:79951_AT |
Chromosome 20 open reading frame 13 |
hs |
MOE430A:1451998_AT |
RIKEN cDNA 4930485D02 gene |
mm |
MOUSE430A_2:1451998_AT |
RIKEN cDNA 4930485D02 gene |
mm |
MOUSE430_2:1451998_AT |
RIKEN cDNA 4930485D02 gene |
mm |
MOE430A:1424810_AT |
RIKEN cDNA 4930485D02 gene |
mm |
MOUSE430A_2:1424810_AT |
RIKEN cDNA 4930485D02 gene |
mm |
MOUSE430_2:1424810_AT |
RIKEN cDNA 4930485D02 gene |
mm |
MG-U74BV2:113239_AT |
RIKEN cDNA 4930485D02 gene, mRNA (cDNA clone MGC:25800 IMAGE:4036044) |
mm |
MG-U74CV2:130132_AT |
RIKEN cDNA 4930485D02 gene, mRNA (cDNA clone MGC:25800 IMAGE:4036044) |
mm |
MU19KSUBA:TC21470_AT |
RIKEN cDNA 4930485D02 gene, mRNA (cDNA clone MGC:25800 IMAGE:4036044) |
mm |
RG-U34B:RC_AA851187_AT |
similar to 4930485D02Rik protein (predicted) |
rn |
RAE230B:1382428_AT |
similar to 4930485D02Rik protein (predicted) |
rn |
RAT230_2:1382428_AT |
similar to 4930485D02Rik protein (predicted) |
rn |
RG-U34C:RC_AI175451_AT |
Similar to 4930485D02Rik protein (predicted) |
rn | |
|
|
|
|
|
6516 |
glycoprotein catabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4067 |
asparaginase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB07249 |
Hypothetical protein K01G5.9 [Caenorhabditis elegans] emb|CAA16341.2| Hypothetical protein K01G5.9 [Caenorhabditis elegans] ref|NP_499377.2| K01G5.9 [Caenorhabditis elegans] |
0.0 |
blast |
CAA16340 |
Hypothetical protein Y39A1B.3 [Caenorhabditis elegans] ref|NP_499379.2| DumPY : shorter than wild-type family member (dpy-28) [Caenorhabditis elegans] |
0.0 |
blast |
AAK81894 |
mutant dosage compensation protein; DPY-28 [Caenorhabditis elegans] |
0.0 |
blast |
CAB07249 |
Hypothetical protein K01G5.9 [Caenorhabditis elegans] emb|CAA16341.2| Hypothetical protein K01G5.9 [Caenorhabditis elegans] ref|NP_499377.2| K01G5.9 [Caenorhabditis elegans] |
1.0E-154 |
blast |
CAE71403 |
Hypothetical protein CBG18312 [Caenorhabditis briggsae] |
1.0E-121 | |
|
|
|
|
|
Pfam |
IPR000246 EMBL-EBI |
Peptidase T2, asparaginase 2 |
7.7E-4 |
Pfam |
IPR007673 EMBL-EBI |
Non-SMC condensin subunit, XCAP-D2/Cnd1 |
1.9E-36 |
Pfam |
IPR007673 EMBL-EBI |
Non-SMC condensin subunit, XCAP-D2/Cnd1 |
1.0E-126 |
Pfam |
IPR000246 EMBL-EBI |
Peptidase T2, asparaginase 2 |
5.5E-5 | |
Sequence |
|
>C. ELEGANS:174164_AT
gatcgaatgtcgctggaatttctgattttccataattgtcgatatcttccggctgcagtt
cgttgtcgagacaatcagattcgtgtttttgaatcacaattcgatccggatcaatgtact
actgatcctaaatgtgttatcgagtcattcatcatgtaataatatgtatatgatatcaag
aattccgcgtttaa
BLASTn GenBank NR |
|
|
|
|
|
|
GATCGAATGTCGCTGGAATTTCTGA |
459 |
417 |
14 |
Antisense |
ATTTCTGATTTTCCATAATTGTCGA |
219 |
17 |
31 |
Antisense |
TAATTGTCGATATCTTCCGGCTGCA |
586 |
633 |
46 |
Antisense |
CGGCTGCAGTTCGTTGTCGAGACAA |
569 |
241 |
63 |
Antisense |
GTCGAGACAATCAGATTCGTGTTTT |
678 |
473 |
78 |
Antisense |
ATTCGTGTTTTTGAATCACAATTCG |
527 |
9 |
92 |
Antisense |
GAATCACAATTCGATCCGGATCAAT |
349 |
327 |
104 |
Antisense |
TCGATCCGGATCAATGTACTACTGA |
526 |
601 |
114 |
Antisense |
GTACTACTGATCCTAAATGTGTTAT |
589 |
459 |
129 |
Antisense |
TGTGTTATCGAGTCATTCATCATGT |
217 |
555 |
146 |
Antisense |
ATGATATCAAGAATTCCGCGTTTAA |
184 |
47 |
183 |
Antisense | |
|
Affymetrix Proprietary Database |