|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
174122_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.21425
|
|
Exemplar sequence
|
|
C59279 NCBI
|
|
C59279_rc /REP_DB=TREMBL Accession /GB=C59279 /CHR=4 /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk386d6 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001028200(11), NM_069133(11), NM_069132(11), NM_001028199(11) |
|
|
|
|
|
NM_001028200 NCBI |
Caenorhabditis elegans EATing: abnormal pharyngeal pumping family member (eat-1) (eat-1) mRNA, complete cds. |
11/11 |
None |
NM_069133 NCBI |
Caenorhabditis elegans EATing: abnormal pharyngeal pumping family member (eat-1) (eat-1) mRNA, complete cds. |
11/11 |
A |
NM_069132 NCBI |
Caenorhabditis elegans EATing: abnormal pharyngeal pumping family member (eat-1) (eat-1) mRNA, complete cds. |
11/11 |
A |
NM_001028199 NCBI |
Caenorhabditis elegans EATing: abnormal pharyngeal pumping family member (eat-1) (eat-1) mRNA, complete cds. |
11/11 |
None |
SNAP00000029869 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:8854528:8857427:1 |
11/11 |
None |
GENEFINDER00000029874 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:8856457:8857427:1 |
11/11 |
None |
T11B7.4d ENSEMBL |
cdna:known chromosome:CEL140:IV:8852482:8862209:1 gene:T11B7.4 |
11/11 |
A |
T11B7.4a ENSEMBL |
cdna:known chromosome:CEL140:IV:8852496:8860416:1 gene:T11B7.4 |
11/11 |
None |
T11B7.4b ENSEMBL |
cdna:known chromosome:CEL140:IV:8852496:8862012:1 gene:T11B7.4 |
11/11 |
A |
T11B7.4c ENSEMBL |
cdna:known chromosome:CEL140:IV:8854519:8862012:1 gene:T11B7.4 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:8857214-8860412(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
T11B7.4
|
Functional Annotations |
|
|
|
|
|
blast |
CAA90991 |
Hypothetical protein T11B7.4d [Caenorhabditis elegans] emb|CAA90978.1| Hypothetical protein T11B7.4d [Caenorhabditis elegans] ref|NP_001023371.1| EATing: abnormal pharyngeal pumping family member (eat-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAE52902 |
Hypothetical protein T11B7.4c [Caenorhabditis elegans] emb|CAE52905.1| Hypothetical protein T11B7.4c [Caenorhabditis elegans] ref|NP_001023370.1| EATing: abnormal pharyngeal pumping family member (eat-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAE52903 |
Hypothetical protein T11B7.4a [Caenorhabditis elegans] emb|CAE52906.1| Hypothetical protein T11B7.4a [Caenorhabditis elegans] ref|NP_501533.2| EATing: abnormal pharyngeal pumping family member (eat-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAB54312 |
Hypothetical protein T11B7.4b [Caenorhabditis elegans] emb|CAB54190.2| Hypothetical protein T11B7.4b [Caenorhabditis elegans] ref|NP_501534.2| EATing: abnormal pharyngeal pumping family member (eat-1) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
1.5E-6 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
3.9E-11 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
3.5E-16 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
8.1E-12 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
3.9E-11 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
3.5E-16 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
8.1E-12 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
1.5E-6 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
3.9E-11 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
3.5E-16 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
8.1E-12 |
Pfam |
IPR001781 EMBL-EBI |
Zn-binding protein, LIM |
1.5E-6 | |
Sequence |
|
>C. ELEGANS:174122_S_AT
ccaactgcagcttttggcgcagatctttcaaagtctgtgacctatggaggaggtgttggt
ccaggtggtactcattacgattctaaccgcttgtcaccagctccatctcaatactcgaca
caatcacggaatcaaagccaacaacactatcaacaacatgttgttc
BLASTn GenBank NR |
|
|
|
|
|
|
CCAACTGCAGCTTTTGGCGCAGATC |
179 |
277 |
24 |
Antisense |
TGCAGCTTTTGGCGCAGATCTTTCA |
199 |
579 |
29 |
Antisense |
GATCTTTCAAAGTCTGTGACCTATG |
150 |
419 |
45 |
Antisense |
AGTCTGTGACCTATGGAGGAGGTGT |
287 |
61 |
55 |
Antisense |
GGAGGTGTTGGTCCAGGTGGTACTC |
253 |
517 |
72 |
Antisense |
GGTCCAGGTGGTACTCATTACGATT |
291 |
497 |
81 |
Antisense |
TCATTACGATTCTAACCGCTTGTCA |
409 |
615 |
95 |
Antisense |
CTCCATCTCAATACTCGACACAATC |
616 |
235 |
124 |
Antisense |
AATACTCGACACAATCACGGAATCA |
179 |
173 |
133 |
Antisense |
ACAATCACGGAATCAAAGCCAACAA |
375 |
115 |
143 |
Antisense |
CAACACTATCAACAACATGTTGTTC |
298 |
189 |
165 |
Antisense | |
|
Affymetrix Proprietary Database |