|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
173992_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.25562
|
|
Exemplar sequence
|
|
CE14F4 NCBI
|
|
CE14F4 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=T04C12.4 /5_PRIME_EXT_DB=WormBase Gene ID /GB=M89051 /WB_GENE_ID=T04C12.4 /WP=CE13148 /CHR=5 /FEA=Genomic Cluster /GEN=act-3 /DEF=actin; CEL14F4 Chris Martin sorted cDNA library Caenorhabditis elegans cDNA clone cm14f4 5prime similar to actin - C. elegans, mRNA sequence.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_073416(11) |
|
|
|
|
|
NM_073416 NCBI |
Caenorhabditis elegans T04C12.4 (actin) mRNA, complete cds. |
11/11 |
None |
T04C12.4.5 ENSEMBL |
cdna:known chromosome:CEL140:V:11074084:11077082:-1 gene:T04C12.4 |
11/11 |
A |
T04C12.4.6 ENSEMBL |
cdna:known chromosome:CEL140:V:11074084:11076048:-1 gene:T04C12.4 |
11/11 |
A |
T04C12.4.4 ENSEMBL |
cdna:known chromosome:CEL140:V:11074084:11075857:-1 gene:T04C12.4 |
11/11 |
A |
T04C12.4.1 ENSEMBL |
cdna:known chromosome:CEL140:V:11074084:11075852:-1 gene:T04C12.4 |
11/11 |
A |
T04C12.4.2 ENSEMBL |
cdna:known chromosome:CEL140:V:11074084:11077086:-1 gene:T04C12.4 |
11/11 |
A |
T04C12.4.3 ENSEMBL |
cdna:known chromosome:CEL140:V:11074086:11075852:-1 gene:T04C12.4 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:11083659-11084891(+) |
81.5 |
81.5 |
|
chrV:11074342-11075832(-) |
100.0 |
100.0 |
|
chrV:11079521-11080715(-) |
76.31 |
76.31 |
| |
Public Domain and Genome References |
|
actin
|
|
act-3
|
|
T04C12.4
|
|
179533 Entrez gene
|
|
P10983 EMBL-EBI
|
|
CE13148 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:250458_S_AT |
actin 7 (ACT7) / actin 2 |
at |
CANINE:1603908_X_AT |
similar to cytoplasmic beta-actin |
cfa |
CANINE:1582872_X_AT |
similar to cytoplasmic beta-actin |
cfa |
CANINE_2:CFAAFFX.15835.1.S1_AT |
similar to cytoplasmic beta-actin |
cfa |
CANINE_2:CFAAFFX.23258.1.S1_X_AT |
similar to cytoplasmic beta-actin |
cfa |
CANINE_2:CFAAFFX.23260.1.S1_X_AT |
similar to cytoplasmic beta-actin |
cfa |
DROSOPHILA_2:1626163_S_AT |
Actin 5C |
dm |
DROSGENOME1:143058_F_AT |
Actin 5C |
dm |
CHICKEN:GGA.4737.1.S1_AT |
actin, cytoplasmic, type 5 |
gga |
CHICKEN:GGA.4520.1.S1_S_AT |
Actin, cytoplasmic, type 5 |
gga |
HG-U133_PLUS_2:210926_AT |
actin-like protein |
hs |
HG-U133A:210926_AT |
actin-like protein |
hs |
HG-U133A_2:210926_AT |
actin-like protein |
hs |
U133_X3P:G12408251_3P_X_AT |
actin-like protein |
hs |
U133_X3P:G12408251_3P_S_AT |
actin-like protein |
hs |
U133_X3P:G12408251_3P_AT |
actin-like protein |
hs |
U133_X3P:210926_3P_AT |
actin-like protein |
hs |
MG-U74AV2:96573_AT |
actin, gamma, cytoplasmic 1 |
mm |
MOUSE430_2:1415779_S_AT |
actin, gamma, cytoplasmic 1 |
mm |
MOUSE430A_2:1415779_S_AT |
actin, gamma, cytoplasmic 1 |
mm |
MOE430A:1415779_S_AT |
actin, gamma, cytoplasmic 1 |
mm |
MU11KSUBA:M21495_F_AT |
actin, gamma, cytoplasmic 1 |
mm |
MU11KSUBB:MSA.42673.0_F_AT |
actin, gamma, cytoplasmic 1 |
mm |
MU11KSUBB:MSA.12411.0_F_AT |
actin, gamma, cytoplasmic 1 |
mm |
MU11KSUBB:MSA.401.0_F_AT |
actin, gamma, cytoplasmic 1 |
mm |
MU19KSUBC:TC39202_F_AT |
Actin, gamma, cytoplasmic 1, mRNA (cDNA clone MGC:30279 IMAGE:3499390) |
mm |
RG-U34A:RC_AA900769_S_AT |
actin, gamma, cytoplasmic (predicted) |
rn |
RG-U34A:X52815CDS_F_AT |
actin, gamma, cytoplasmic (predicted) |
rn |
RG-U34B:RC_AA964496_S_AT |
actin, gamma, cytoplasmic (predicted) |
rn |
RG-U34C:RC_AI104357_AT |
actin, gamma, cytoplasmic (predicted) |
rn |
RAE230A:1371327_A_AT |
actin, gamma, cytoplasmic (predicted) |
rn |
RAT230_2:1371327_A_AT |
actin, gamma, cytoplasmic (predicted) |
rn |
RAE230B:1384581_AT |
actin, gamma, cytoplasmic (predicted) |
rn |
RAT230_2:1384581_AT |
actin, gamma, cytoplasmic (predicted) |
rn |
YEAST_2:1769719_AT |
Actin, structural protein involved in cell polarization, endocytosis, and other cytoskeletal functions |
Sc | |
|
|
|
|
|
5884 |
actin filament |
inferred from electronic annotation |
QuickGO AmiGO |
15629 |
actin cytoskeleton |
inferred from electronic annotation |
QuickGO AmiGO |
5856 |
cytoskeleton |
inferred from sequence similarity |
QuickGO AmiGO |
|
|
|
|
3774 |
motor activity |
inferred from electronic annotation |
QuickGO AmiGO |
5200 |
structural constituent of cytoskeleton |
inferred from electronic annotation |
QuickGO AmiGO |
5200 |
structural constituent of cytoskeleton |
inferred from sequence similarity |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB04678 |
Hypothetical protein T04C12.6 [Caenorhabditis elegans] emb|CAB04676.1| Hypothetical protein T04C12.4 [Caenorhabditis elegans] ref|NP_505819.1| T04C12.6 [Caenorhabditis elegans] ref|NP_505817.1| T04C12.4 [Caenorhabditis elegans] sp|P10983|ACT1_CAEEL Actin-1/3 emb|CAA34717.1| actin [Caenorhabditis elegans] |
0.0 |
blast |
AAR21857 |
actin [Cooperia oncophora] gb|AAB04575.1| Actin protein 4, isoform a [Caenorhabditis elegans] emb|CAA34720.1| actin [Caenorhabditis elegans] ref|NP_508841.1| ACTin family member (act-4) [Caenorhabditis elegans] gb|AAY52453.1| actin [Caenorhabditis remanei] sp|P10986|ACT4_CAEEL Actin-4 emb|CAE68670.1| Hypothetical protein CBG14574 [Caenorhabditis briggsae] emb|CAE75153.1| Hypothetical protein CBG23090 [Caenorhabditis briggsae] |
0.0 |
blast |
1D4X |
Chain , Crystal Structure Of Caenorhabditis Elegans Mg-Atp Actin Complexed With Human Gelsolin Segment 1 At 1.75 A Resolution |
0.0 | |
|
|
|
|
|
Pfam |
IPR004000 EMBL-EBI |
Actin/actin-like |
1.0E-126 | |
Sequence |
|
>C. ELEGANS:173992_AT
cgcaagtgcttctaagctcttcgccttaccattttctcttttctttcttttttctataca
tttttttccaattgtcaccaaatcgttatggtcccttttggggcaataacaaattctatc
atcatttcacgatcatgagaccattcaaaaagaccatcaagattttatttccgatcctgc
cacataagaagaccccactacaatttgctctgttctttgttttgtgcatat
BLASTn GenBank NR |
|
|
|
|
|
|
CGCAAGTGCTTCTAAGCTCTTCGCC |
668 |
253 |
1130 |
Antisense |
TTTTTCCAATTGTCACCAAATCGTT |
555 |
673 |
1192 |
Antisense |
TCGTTATGGTCCCTTTTGGGGCAAT |
352 |
601 |
1212 |
Antisense |
AATTCTATCATCATTTCACGATCAT |
227 |
177 |
1241 |
Antisense |
ATTTCACGATCATGAGACCATTCAA |
149 |
15 |
1253 |
Antisense |
GAGACCATTCAAAAAGACCATCAAG |
459 |
393 |
1266 |
Antisense |
CAAGATTTTATTTCCGATCCTGCCA |
536 |
183 |
1287 |
Antisense |
GATCCTGCCACATAAGAAGACCCCA |
128 |
417 |
1302 |
Antisense |
TAAGAAGACCCCACTACAATTTGCT |
134 |
421 |
1314 |
Antisense |
CCCACTACAATTTGCTCTGTTCTTT |
146 |
259 |
1323 |
Antisense |
GCTCTGTTCTTTGTTTTGTGCATAT |
358 |
299 |
1336 |
Antisense | |
|
Affymetrix Proprietary Database |