|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
173894_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.25309
|
|
Exemplar sequence
|
|
C44132 NCBI
|
|
C44132 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=C52E4.4 /5_PRIME_EXT_DB=WormBase Gene ID /GB=C44132 /WB_GENE_ID=C52E4.4 /WP=CE08946 /CHR=5 /FEA=Genomic Cluster /GEN=rpt-1 /DEF=26S protease regulatory subunit 7; C.elegans cDNA clone yk339d4 : 5prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_073604(11) |
|
|
|
|
|
NM_073604 NCBI |
Caenorhabditis elegans proteasome Regulatory Particle, ATPase-like family member (rpt-1) (rpt-1) mRNA, complete cds. |
11/11 |
None |
SNAP00000019786 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:11983324:11984982:-1 |
11/11 |
None |
GENEFINDER00000019795 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:11983324:11984982:-1 |
11/11 |
None |
C52E4.4.2 ENSEMBL |
cdna:known chromosome:CEL140:V:11983064:11985024:-1 gene:C52E4.4 |
11/11 |
A |
C52E4.4.3 ENSEMBL |
cdna:known chromosome:CEL140:V:11983064:11985058:-1 gene:C52E4.4 |
11/11 |
None |
C52E4.4.1 ENSEMBL |
cdna:known chromosome:CEL140:V:11983064:11984985:-1 gene:C52E4.4 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:11983145-11984983(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
26S protease regulatory subunit 7
|
|
rpt-1
|
|
C52E4.4
|
|
179641 Entrez gene
|
|
Q18787 EMBL-EBI
|
|
CE08946 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:262227_S_AT |
26S proteasome AAA-ATPase subunit (RPT1a) |
at |
CANINE:1590974_S_AT |
similar to proteasome (prosome, macropain) 26S subunit, ATPase 2 |
cfa |
CANINE:1591564_AT |
similar to proteasome (prosome, macropain) 26S subunit, ATPase 2 |
cfa |
CANINE_2:CFA.281.1.S1_S_AT |
similar to proteasome (prosome, macropain) 26S subunit, ATPase 2 |
cfa |
DROSOPHILA_2:1630925_AT |
|
dm |
DROSGENOME1:143012_AT |
|
dm |
CHICKEN:GGAAFFX.11569.1.S1_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
gga |
HG-U133A:201068_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HG-U133_PLUS_2:201068_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HG-U133A_2:201068_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HG-FOCUS:201068_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HG-U133_PLUS_2:201067_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HG-U133A_2:201067_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HG-U133A:201067_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HUGENEFL:D11094_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
U133_X3P:G4506208_3P_A_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HG-U95AV2:35353_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
HG-U95B:51032_AT |
proteasome (prosome, macropain) 26S subunit, ATPase, 2 |
hs |
MOE430A:1426611_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MOUSE430_2:1426611_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MOUSE430A_2:1426611_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MU11KSUBB:MSA.38164.0_F_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MU11KSUBB:MSA.10666.0_F_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MG-U74AV2:95448_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MOE430A:1435859_X_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MOUSE430A_2:1435859_X_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MOUSE430_2:1435859_X_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
mm |
MOE430B:1443307_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase 2, mRNA (cDNA clone MGC:6418 IMAGE:3590739) |
mm |
MOUSE430_2:1443307_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase 2, mRNA (cDNA clone MGC:6418 IMAGE:3590739) |
mm |
MU11KSUBA:AA061073_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase 2, mRNA (cDNA clone MGC:6418 IMAGE:3590739) |
mm |
MU11KSUBB:MSA.15677.0_F_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase 2, mRNA (cDNA clone MGC:6418 IMAGE:3590739) |
mm |
MU19KSUBA:TC23050_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase 2, mRNA (cDNA clone MGC:6418 IMAGE:3590739) |
mm |
MU19KSUBA:TC23050_G_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase 2, mRNA (cDNA clone MGC:6418 IMAGE:3590739) |
mm |
MU19KSUBB:TC34667_F_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase 2, mRNA (cDNA clone MGC:6418 IMAGE:3590739) |
mm |
MU19KSUBB:TC34667_R_AT |
Proteasome (prosome, macropain) 26S subunit, ATPase 2, mRNA (cDNA clone MGC:6418 IMAGE:3590739) |
mm |
RG-U34A:D50694_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
rn |
RG-U34A:U13895_S_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
rn |
RAE230A:1367711_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
rn |
RAT230_2:1367711_AT |
proteasome (prosome, macropain) 26S subunit, ATPase 2 |
rn |
YEAST_2:1777554_AT |
One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degradation of ubiquitinated substrates; required for optimal CDC20 transcription; interacts with Rpn12p and the E3 ubiquitin-protein ligase Ubr1p |
Sc | |
|
|
|
|
|
30163 |
protein catabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
5737 |
cytoplasm |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
166 |
nucleotide binding |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
16787 |
hydrolase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB01414 |
Hypothetical protein C52E4.4 [Caenorhabditis elegans] ref|NP_506005.1| proteasome Regulatory Particle, ATPase-like family member (rpt-1) [Caenorhabditis elegans] sp|Q18787|PRS7_CAEEL Probable 26S protease regulatory subunit |
0.0 |
blast |
CAE75362 |
Hypothetical protein CBG23346 [Caenorhabditis briggsae] |
0.0 |
blast |
CAH91973 |
hypothetical protein [Pongo pygmaeus] |
0.0 | |
|
|
|
|
|
Pfam |
IPR003959 EMBL-EBI |
AAA ATPase, central region |
4.3E-88 | |
Sequence |
|
>C. ELEGANS:173894_S_AT
gaagttcaacgtactatgctcgagttgattaaccaacttgacggattcgatccacgtgga
aacatcaaggtgcttatggcaacaaacagaccggacactctcgatcccgctctcatgaga
cctggtcgattggatcgtaaagtcgaattcgctcttccagaccttgcaggtcgtgctcac
attctcaagattcatgcaaaacaaatgagcgttgaaagagatattcgttatgatttactt
gctcgtctgtgcccaaacagtacaggagccgaaattcgctcagtctgcaccgaagctgga
atgtttgcaattcgtgctagaagaaaggtggcaactgaaaaagatttccttgaagctatc
aataaggttgtcaagggatatgccaaattcagcgccactccaagatatctgaca
BLASTn GenBank NR |
|
|
|
|
|
|
GAAGTTCAACGTACTATGCTCGAGT |
417 |
337 |
899 |
Antisense |
TAACCAACTTGACGGATTCGATCCA |
540 |
637 |
928 |
Antisense |
AACAAACAGACCGGACACTCTCGAT |
160 |
135 |
979 |
Antisense |
TAAAGTCGAATTCGCTCTTCCAGAC |
255 |
639 |
1036 |
Antisense |
AGACCTTGCAGGTCGTGCTCACATT |
200 |
71 |
1057 |
Antisense |
GTGCTCACATTCTCAAGATTCATGC |
512 |
479 |
1071 |
Antisense |
TATGATTTACTTGCTCGTCTGTGCC |
39 |
657 |
1127 |
Antisense |
GTGCCCAAACAGTACAGGAGCCGAA |
706 |
477 |
1147 |
Antisense |
GAGCCGAAATTCGCTCAGTCTGCAC |
66 |
387 |
1164 |
Antisense |
GGATATGCCAAATTCAGCGCCACTC |
169 |
511 |
1274 |
Antisense |
CAGCGCCACTCCAAGATATCTGACA |
320 |
203 |
1288 |
Antisense | |
|
Affymetrix Proprietary Database | |