|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
173859_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.22893
|
|
Exemplar sequence
|
|
AV200180 NCBI
|
|
AV200180_rc /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=Y110A7A.12 /5_PRIME_EXT_DB=WormBase Gene ID /GB=AV200180 /WB_GENE_ID=Y110A7A.12 /WP=CE23245 /CHR=1 /FEA=Genomic Cluster /DEF=ATP synthase; Caenorhabditis elegans cDNA clone:yk558a12 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_059117(11) |
|
|
|
|
|
NM_059117 NCBI |
Caenorhabditis elegans Temporarily Assigned Gene name family member (tag-300) (tag-300) mRNA, complete cds. |
11/11 |
None |
SNAP00000029201 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:5101756:5103404:-1 |
11/11 |
None |
GENEFINDER00000029233 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:5101756:5103404:-1 |
11/11 |
None |
Y110A7A.12 ENSEMBL |
cdna:known chromosome:CEL140:I:5101756:5103404:-1 gene:Y110A7A.12 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:5101746-5103405(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ATP synthase
|
|
tag-300
|
|
Y110A7A.12
|
|
172137 Entrez gene
|
|
Q9N5A0 EMBL-EBI
|
|
CE23245 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:262684_S_AT |
vacuolar ATP synthase subunit B, putative / V-ATPase B subunit, putative / vacuolar proton pump B subunit, putative / V-ATPase 57 kDa subunit, putative |
at |
CANINE:1596371_S_AT |
similar to ATPase, H+ transporting, V1 subunit B, isoform 2 |
cfa |
CANINE:1596370_AT |
similar to ATPase, H+ transporting, V1 subunit B, isoform 2 |
cfa |
CANINE:1588939_AT |
similar to ATPase, H+ transporting, V1 subunit B, isoform 2 |
cfa |
CANINE:1585797_AT |
similar to ATPase, H+ transporting, V1 subunit B, isoform 2 |
cfa |
CANINE_2:CFA.20851.1.S1_S_AT |
similar to ATPase, H+ transporting, V1 subunit B, isoform 2 |
cfa |
CANINE_2:CFA.2297.1.A1_AT |
similar to ATPase, H+ transporting, V1 subunit B, isoform 2 |
cfa |
CANINE_2:CFAAFFX.15827.1.S1_S_AT |
similar to ATPase, H+ transporting, V1 subunit B, isoform 2 |
cfa |
DROSOPHILA_2:1625131_S_AT |
Vacuolar H+-ATPase 55kD B subunit |
dm |
DROSGENOME1:153041_AT |
Vacuolar H+-ATPase 55kD B subunit |
dm |
CHICKEN:GGA.3876.1.S1_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
gga |
HU35KSUBA:M60346_S_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
HG-U133_PLUS_2:201089_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
HG-FOCUS:201089_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
HG-U133A:201089_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
HG-U133A_2:201089_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
HUGENEFL:L35249_S_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
U133_X3P:G4502310_3P_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
HG-U95AV2:40568_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
HG-U95E:70255_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
HU35KSUBA:W27470_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 |
hs |
MOE430A:1419883_S_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MOUSE430A_2:1419883_S_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MOUSE430_2:1419883_S_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MOUSE430_2:1415814_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MOE430A:1415814_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MOUSE430A_2:1415814_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MU11KSUBB:MSA.1868.0_S_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MU11KSUBB:MSA.11096.0_F_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MG-U74AV2:92598_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MG-U74AV2:92597_S_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MG-U74CV2:138577_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MG-U74BV2:164537_R_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
mm |
MOE430A:1449649_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
MOUSE430A_2:1449649_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
MOUSE430_2:1449649_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
MG-U74CV2:131277_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
MOE430B:1446465_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
MOUSE430_2:1446465_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
MG-U74CV2:169110_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
MU19KSUBA:TC25261_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
MU19KSUBB:TC33557_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2, mRNA (cDNA clone MGC:21587 IMAGE:4500843) |
mm |
RG-U34A:Y12635_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
rn |
RG-U34C:RC_AI227667_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
rn |
RAE230A:1371402_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
rn |
RAT230_2:1371402_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
rn |
RAE230A:1387664_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
rn |
RAT230_2:1387664_AT |
ATPase, H+ transporting, V1 subunit B, isoform 2 |
rn |
YEAST_2:1777396_AT |
Subunit B of the eight-subunit V1 peripheral membrane domain of the vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found throughout the endomembrane system; contains nucleotide binding sites; also detected in the cytoplasm |
Sc | |
|
|
|
|
|
6754 |
ATP biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
15988 |
energy coupled proton transport, against electrochemical gradient |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5737 |
cytoplasm |
inferred from electronic annotation |
QuickGO AmiGO |
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
8553 |
hydrogen-exporting ATPase activity, phosphorylative mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAF60418 |
Temporarily assigned gene name protein 300 [Caenorhabditis elegans] ref|NP_491518.1| Temporarily Assigned Gene name family member (tag-300) [Caenorhabditis elegans] |
0.0 |
blast |
CAE65728 |
Hypothetical protein CBG10811 [Caenorhabditis briggsae] |
0.0 |
blast |
AAA82311 |
Vacuolar h atpase protein 12 [Caenorhabditis elegans] ref|NP_508711.1| Vacuolar H ATPase family member (vha-12) [Caenorhabditis elegans] sp|Q19626|VATB_CAEEL Probable vacuolar ATP synthase subunit B (V-ATPase B subunit) (Vacuolar proton pump B subunit) |
0.0 | |
|
|
|
|
|
Pfam |
IPR004100 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, N-terminal |
1.1E-15 |
Pfam |
IPR000194 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, central region |
1.3E-80 |
Pfam |
IPR000793 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, C-terminal |
8.8E-26 | |
Sequence |
|
>C. ELEGANS:173859_S_AT
tgagagagatctctgctgctcgtgaagaagttcctggacgtcgtggattccctgggtaca
tgtacacggatttggcaacgatctatgaaagagctggtcgtgtgaaaggtcgtgaaggat
ccattacacaaattccgatcctaactatgccgaataacgacattacccatccgattcccg
atctcactggatacatcactgagggtcagatctacatcgacaagcagcttcacaaaaggt
tgatctatccaccaatcgatgtcctcccatcattgtctcgccttatgaagtcagctgttg
gagagggaatgacacgggaagatcattcagatctttcaaatcagctttacgcgtgttatg
ctatgggaaaagatgtccaggcgatgaaggctgttgttggcgtggaagcactatctcctg
atgatctgttgtacctggagttccttgcgaagttcgagaagaattttattgcacaaggac
gctatgaaaacagaaccatcgtcgagtctctgaatattggatgggaacttttgagaatct
ttccaagagaaatgctcaaaagaatcccggaaactctcttagaga
BLASTn GenBank NR |
|
|
|
|
|
|
TGAGAGAGATCTCTGCTGCTCGTGA |
558 |
567 |
909 |
Antisense |
ACGTCGTGGATTCCCTGGGTACATG |
330 |
91 |
946 |
Antisense |
AAATTCCGATCCTAACTATGCCGAA |
203 |
115 |
1038 |
Antisense |
CGAATAACGACATTACCCATCCGAT |
407 |
251 |
1059 |
Antisense |
GATTCCCGATCTCACTGGATACATC |
97 |
433 |
1081 |
Antisense |
GTCTCGCCTTATGAAGTCAGCTGTT |
697 |
465 |
1183 |
Antisense |
GAAGCACTATCTCCTGATGATCTGT |
356 |
341 |
1313 |
Antisense |
GATGATCTGTTGTACCTGGAGTTCC |
439 |
411 |
1328 |
Antisense |
CCTGGAGTTCCTTGCGAAGTTCGAG |
665 |
263 |
1342 |
Antisense |
GAACCATCGTCGAGTCTCTGAATAT |
584 |
343 |
1401 |
Antisense |
AGAATCCCGGAAACTCTCTTAGAGA |
150 |
75 |
1469 |
Antisense | |
|
Affymetrix Proprietary Database | |