|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
173838_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.22672
|
|
Exemplar sequence
|
|
AV194445 NCBI
|
|
AV194445 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=K07A1.8 /5_PRIME_EXT_DB=WormBase Gene ID /GB=AV194445 /WB_GENE_ID=K07A1.8 /WP=CE11854 /CHR=1 /FEA=Genomic Cluster /DEF=P58 protein like; Caenorhabditis elegans cDNA clone:yk629e4 : 5prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_060147(11) |
|
|
|
|
|
NM_060147 NCBI |
Caenorhabditis elegans Intracellular LEctin family member (ile-1) (ile-1) mRNA, complete cds. |
11/11 |
None |
K07A1.8.3 ENSEMBL |
cdna:known chromosome:CEL140:I:9617636:9619658:-1 gene:K07A1.8 |
11/11 |
None |
K07A1.8.1 ENSEMBL |
cdna:known chromosome:CEL140:I:9617636:9619707:-1 gene:K07A1.8 |
11/11 |
A |
K07A1.8.2 ENSEMBL |
cdna:known chromosome:CEL140:I:9617636:9619656:-1 gene:K07A1.8 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:9617625-9619586(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
P58 protein like
|
|
ile-1
|
|
K07A1.8
|
|
172799 Entrez gene
|
|
P90913 EMBL-EBI
|
|
CE11854 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1587465_AT |
similar to ERGIC-53 protein precursor (ER-Golgi intermediate compartment 53 kDa protein) (Lectin, mannose-binding 1) (Gp58) (Intracellular mannose specific lectin MR60) |
cfa |
CANINE_2:CFAAFFX.1112.1.S1_S_AT |
similar to ERGIC-53 protein precursor (ER-Golgi intermediate compartment 53 kDa protein) (Lectin, mannose-binding 1) (Gp58) (Intracellular mannose specific lectin MR60) |
cfa |
DROSOPHILA_2:1640635_A_AT |
|
dm |
DROSOPHILA_2:1624560_AT |
|
dm |
DROSGENOME1:155025_AT |
|
dm |
CHICKEN:GGA.1035.2.S1_A_AT |
lectin, mannose-binding, 1 |
gga |
CHICKEN:GGA.2274.1.S1_A_AT |
Similar to ERGIC-53 protein precursor (ER-Golgi intermediate compartment 53 kDa protein) (Lectin, mannose-binding 1) (Gp58) (Intracellular mannose specific lectin MR60) |
gga |
HG-U133A:203293_S_AT |
lectin, mannose-binding, 1 |
hs |
HG-U133_PLUS_2:203293_S_AT |
lectin, mannose-binding, 1 |
hs |
HG-FOCUS:203293_S_AT |
lectin, mannose-binding, 1 |
hs |
HG-U133A_2:203293_S_AT |
lectin, mannose-binding, 1 |
hs |
HG-U133A:203294_S_AT |
lectin, mannose-binding, 1 |
hs |
HG-U133A_2:203294_S_AT |
lectin, mannose-binding, 1 |
hs |
HG-U133_PLUS_2:203294_S_AT |
lectin, mannose-binding, 1 |
hs |
HU35KSUBD:RC_AA600257_S_AT |
lectin, mannose-binding, 1 |
hs |
HUGENEFL:X71661_AT |
lectin, mannose-binding, 1 |
hs |
HUGENEFL:U09716_S_AT |
lectin, mannose-binding, 1 |
hs |
U133_X3P:G606827_3P_A_AT |
lectin, mannose-binding, 1 |
hs |
U133_X3P:G10862689_3P_S_AT |
lectin, mannose-binding, 1 |
hs |
HU35KSUBA:RC_AA452855_AT |
Lectin, mannose-binding, 1 |
hs |
HU35KSUBA:AA404252_AT |
Lectin, mannose-binding, 1 |
hs |
HU35KSUBC:RC_AA243495_AT |
Lectin, mannose-binding, 1 |
hs |
HU35KSUBD:RC_AA459256_AT |
Lectin, mannose-binding, 1 |
hs |
U133_X3P:HS.5822.0.S1_3P_AT |
Lectin, mannose-binding, 1 |
hs |
HG-U133_PLUS_2:224629_AT |
Lectin, mannose-binding, 1 |
hs |
HG-U133B:224629_AT |
Lectin, mannose-binding, 1 |
hs |
HG-U95AV2:34734_AT |
Lectin, mannose-binding, 1 |
hs |
HG-U95C:64263_S_AT |
Lectin, mannose-binding, 1 |
hs |
HG-U95C:65907_R_AT |
Lectin, mannose-binding, 1 |
hs |
MU11KSUBB:W40847_AT |
lectin, mannose-binding, 1 |
mm |
MU11KSUBB:W40847_G_AT |
lectin, mannose-binding, 1 |
mm |
MG-U74BV2:112766_AT |
lectin, mannose-binding, 1 |
mm |
MG-U74AV2:161288_R_AT |
lectin, mannose-binding, 1 |
mm |
MG-U74AV2:160270_AT |
lectin, mannose-binding, 1 |
mm |
MOE430A:1428129_AT |
lectin, mannose-binding, 1 |
mm |
MOUSE430A_2:1428129_AT |
lectin, mannose-binding, 1 |
mm |
MOUSE430_2:1428129_AT |
lectin, mannose-binding, 1 |
mm |
MOE430A:1428130_AT |
lectin, mannose-binding, 1 |
mm |
MOUSE430A_2:1428130_AT |
lectin, mannose-binding, 1 |
mm |
MOUSE430_2:1428130_AT |
lectin, mannose-binding, 1 |
mm |
MOE430A:1452671_S_AT |
lectin, mannose-binding, 1 |
mm |
MOUSE430A_2:1452671_S_AT |
lectin, mannose-binding, 1 |
mm |
MOUSE430_2:1452671_S_AT |
lectin, mannose-binding, 1 |
mm |
MOE430A:1419951_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MOUSE430A_2:1419951_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MOUSE430_2:1419951_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MOE430B:1444037_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MOUSE430_2:1444037_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MG-U74CV2:168563_R_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MU19KSUBA:TC19935_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MU19KSUBA:TC19935_G_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MU19KSUBA:TC23910_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MU19KSUBA:TC23910_G_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MU19KSUBC:TC38028_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
MU11KSUBA:D18928_RC_AT |
Lectin, mannose-binding, 1 (Lman1), mRNA |
mm |
RG-U34A:U44129_AT |
lectin, mannose-binding, 1 |
rn |
RAE230A:1368848_AT |
lectin, mannose-binding, 1 |
rn |
RAT230_2:1368848_AT |
lectin, mannose-binding, 1 |
rn |
RAE230B:1385238_AT |
Lectin, mannose-binding, 1 |
rn |
RAT230_2:1385238_AT |
Lectin, mannose-binding, 1 |
rn |
RG-U34A:RC_AA997526_AT |
Lectin, mannose-binding, 1 |
rn |
RG-U34A:RC_AI137470_AT |
Lectin, mannose-binding, 1 |
rn | |
|
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB03169 |
Hypothetical protein K07A1.8 [Caenorhabditis elegans] ref|NP_492548.1| Intracellular LEctin family member (ile-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAE60162 |
Hypothetical protein CBG03714 [Caenorhabditis briggsae] |
0.0 |
blast |
XP_780803 |
PREDICTED: similar to CG6822-PA, isoform A [Strongylocentrotus purpuratus] |
1.0E-99 | |
|
|
|
|
|
Pfam |
IPR005052 EMBL-EBI |
Legume-like lectin |
1.0E-126 |
NP_492548.1 |
1 |
460-482 |
K07A1.8.3 |
1 |
460-482 |
K07A1.8.1 |
1 |
460-482 |
K07A1.8.2 |
1 |
460-482 | |
Sequence |
|
>C. ELEGANS:173838_AT
aatttattgcattctaaccatcattaactaacaatgtctttccccttcgaacctgtcgtc
aaatgtgatgttttgttctcaatacagcgtatttacgacattatcgcgaccccacaacga
attttcttattcaaaaaatcccctggtaaataatatcatctcacccctgattgtgttgtg
ttttagtcagatttcccccg
BLASTn GenBank NR |
|
|
|
|
|
|
AATTTATTGCATTCTAACCATCATT |
449 |
175 |
1491 |
Antisense |
GCATTCTAACCATCATTAACTAACA |
546 |
305 |
1499 |
Antisense |
CATTAACTAACAATGTCTTTCCCCT |
622 |
213 |
1512 |
Antisense |
CCCCTTCGAACCTGTCGTCAAATGT |
177 |
1 |
1532 |
Antisense |
GAACCTGTCGTCAAATGTGATGTTT |
133 |
347 |
1539 |
Antisense |
GATGTTTTGTTCTCAATACAGCGTA |
51 |
411 |
1557 |
Antisense |
TATTTACGACATTATCGCGACCCCA |
291 |
661 |
1580 |
Antisense |
AAATCCCCTGGTAAATAATATCATC |
144 |
119 |
1626 |
Antisense |
ATAATATCATCTCACCCCTGATTGT |
50 |
27 |
1640 |
Antisense |
ATCTCACCCCTGATTGTGTTGTGTT |
529 |
29 |
1648 |
Antisense |
TTGTGTTTTAGTCAGATTTCCCCCG |
562 |
695 |
1666 |
Antisense | |
|
Affymetrix Proprietary Database | |