|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
173795_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.22578
|
|
Exemplar sequence
|
|
CEK004A6F NCBI
|
|
CEK004A6F /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F14B4.3 /5_PRIME_EXT_DB=WormBase Gene ID /GB=D27184 /WB_GENE_ID=F14B4.3 /WP=CE05629 /CHR=1 /FEA=Genomic Cluster /DEF=DNA-directed RNA polymerase I; C.elegans cDNA clone yk4a6 : 5prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_060075(11) |
|
|
|
|
|
NM_060075 NCBI |
Caenorhabditis elegans F14B4.3 (F14B4.3) mRNA, complete cds. |
11/11 |
None |
F14B4.3 ENSEMBL |
cdna:known chromosome:CEL140:I:9289086:9294685:-1 gene:F14B4.3 |
11/11 |
A | |
GENEFINDER00000033145 |
2/11 |
Cross Hyb Matching Probes |
None | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:9289043-9294617(-) |
98.62 |
100.0 |
| |
Public Domain and Genome References |
|
DNA-directed RNA polymerase I
|
|
F14B4.3
|
|
172752 Entrez gene
|
|
Q27493 EMBL-EBI
|
|
CE05629 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:260049_AT |
DNA-directed RNA polymerase family protein |
at |
DROSOPHILA_2:1627924_AT |
RNA polymerase I 135kD subunit |
dm |
DROSGENOME1:141487_AT |
RNA polymerase I 135kD subunit |
dm |
CHICKEN:GGA.16760.1.S1_AT |
similar to RNA polymerase I polypeptide B; DNA-directed RNA polymerase I 135kDa polypeptide; RNA polymerase I subunit 2 |
gga |
CHICKEN:GGA.16760.1.S1_S_AT |
similar to RNA polymerase I polypeptide B; DNA-directed RNA polymerase I 135kDa polypeptide; RNA polymerase I subunit 2 |
gga |
CHICKEN:GGA.6256.2.S1_A_AT |
similar to RNA polymerase I polypeptide B; DNA-directed RNA polymerase I 135kDa polypeptide; RNA polymerase I subunit 2 |
gga |
HG-U133_PLUS_2:220113_X_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U133A:220113_X_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-FOCUS:220113_X_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U133A_2:220113_X_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U133_PLUS_2:233341_S_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U133B:233341_S_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U133B:223403_S_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U133_PLUS_2:223403_S_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HU35KSUBC:RC_AA460359_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
U133_X3P:G13436127_3P_A_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
U133_X3P:HS2.212849.1.S1_3P_X_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
U133_X3P:HS.86337.2.S1_3P_A_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
U133_X3P:1557331_3P_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U133_PLUS_2:1557331_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U95C:62960_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U95E:83482_R_AT |
polymerase (RNA) I polypeptide B, 128kDa |
hs |
HG-U95E:79008_AT |
Polymerase (RNA) I polypeptide B, 128kDa |
hs |
MU11KSUBA:U58280_S_AT |
RNA polymerase 1-2 |
mm |
MG-U74AV2:92225_F_AT |
RNA polymerase 1-2 |
mm |
MOE430A:1416126_AT |
RNA polymerase 1-2 |
mm |
MOUSE430A_2:1416126_AT |
RNA polymerase 1-2 |
mm |
MOUSE430_2:1416126_AT |
RNA polymerase 1-2 |
mm |
RG-U34A:AF025424_AT |
RNA polymerase 1-2 |
rn |
RG-U34B:RC_AI011980_AT |
RNA polymerase 1-2 |
rn |
RAE230A:1387268_AT |
RNA polymerase 1-2 |
rn |
RAT230_2:1387268_AT |
RNA polymerase 1-2 |
rn |
YEAST_2:1771463_AT |
RNA polymerase I subunit A135 |
Sc | |
|
|
|
|
|
6350 |
transcription |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO |
3899 |
DNA-directed RNA polymerase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA99827 |
Hypothetical protein F14B4.3 [Caenorhabditis elegans] ref|NP_492476.1| F14B4.3 [Caenorhabditis elegans] |
0.0 |
blast |
CAE72324 |
Hypothetical protein CBG19469 [Caenorhabditis briggsae] |
0.0 |
blast |
AAH97040 |
Hypothetical protein LOC393490 [Danio rerio] ref|NP_956812.2| hypothetical protein LOC393490 [Danio rerio] |
0.0 | |
|
|
|
|
|
Pfam |
IPR007641 EMBL-EBI |
RNA polymerase Rpb2, domain 7 |
3.5E-21 |
Pfam |
IPR009674 EMBL-EBI |
RNA polymerase I, Rpa2 specific |
9.9E-38 |
Pfam |
IPR007644 EMBL-EBI |
RNA polymerase beta subunit |
4.9E-26 |
Pfam |
IPR007645 EMBL-EBI |
RNA polymerase Rpb2, domain 3 |
1.3E-33 |
Pfam |
IPR007647 EMBL-EBI |
RNA polymerase Rpb2, domain 5 |
9.9E-12 |
Pfam |
IPR007120 EMBL-EBI |
RNA polymerase Rpb2, domain 6 |
1.2E-50 |
Pfam |
IPR007120 EMBL-EBI |
RNA polymerase Rpb2, domain 6 |
1.0E-94 | |
Sequence |
|
>C. ELEGANS:173795_AT
attttttcaacatttccttcataatagaaatactgaaaacttcatgcagttctctaaact
ttgatttttaaaaaatttcttttacactacactttaatattctccgtcccctatcctaca
acaatctcacggtttttgtctattttttgttattttctctttgcaagttgttttattgtt
gaaccttttctgaaatttttgatttttagccgattttagcaatttttgttacttttttgt
ttaccctcatccaatttattctgtttc
BLASTn GenBank NR |
|
|
|
|
|
|
ATTTTTTCAACATTTCCTTCATAAT |
419 |
15 |
3405 |
Antisense |
AACTTCATGCAGTTCTCTAAACTTT |
325 |
139 |
3442 |
Antisense |
CACTACACTTTAATATTCTCCGTCC |
577 |
197 |
3489 |
Antisense |
CCCTATCCTACAACAATCTCACGGT |
9 |
261 |
3513 |
Antisense |
CAATCTCACGGTTTTTGTCTATTTT |
486 |
181 |
3526 |
Antisense |
GTTATTTTCTCTTTGCAAGTTGTTT |
482 |
447 |
3553 |
Antisense |
GCAAGTTGTTTTATTGTTGAACCTT |
322 |
303 |
3567 |
Antisense |
TTTTGATTTTTAGCCGATTTTAGCA |
404 |
675 |
3601 |
Antisense |
GCCGATTTTAGCAATTTTTGTTACT |
614 |
265 |
3613 |
Antisense |
TTTTGTTTACCCTCATCCAATTTAT |
513 |
673 |
3639 |
Antisense |
ACCCTCATCCAATTTATTCTGTTTC |
322 |
91 |
3647 |
Antisense | |
|
Affymetrix Proprietary Database |