|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
173773_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.25213
|
|
Exemplar sequence
|
|
C45838 NCBI
|
|
C45838 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=C16D9.2 /5_PRIME_EXT_DB=WormBase Gene ID /GB=C45838 /WB_GENE_ID=C16D9.2 /WP=CE06838 /CHR=5 /FEA=Genomic Cluster /DEF=tyrosine-protein kinase; C.elegans cDNA clone yk402e9 : 5prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_182327(11), NM_072721(11) |
|
|
|
|
|
NM_182327 NCBI |
Caenorhabditis elegans ROLler: helically twisted, animals roll when moving family member (rol-3) (rol-3) mRNA, complete cds. |
11/11 |
None |
NM_072721 NCBI |
Caenorhabditis elegans ROLler: helically twisted, animals roll when moving family member (rol-3) (rol-3) mRNA, complete cds. |
11/11 |
None |
SNAP00000043373 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:8231110:8237268:-1 |
11/11 |
None |
C16D9.2c ENSEMBL |
cdna:known chromosome:CEL140:V:8230891:8235929:-1 gene:C16D9.2 |
11/11 |
A |
C16D9.2a ENSEMBL |
cdna:known chromosome:CEL140:V:8231110:8240941:-1 gene:C16D9.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:8230945-8240943(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
C16D9.2
|
Functional Annotations |
|
|
|
|
|
blast |
AAN84864 |
Roller: helically twisted, animals roll when moving protein 3, isoform a [Caenorhabditis elegans] ref|NP_505122.3| ROLler: helically twisted, animals roll when moving family member (rol-3) [Caenorhabditis elegans] |
0.0 |
blast |
AAN84866 |
Roller: helically twisted, animals roll when moving protein 3, isoform c [Caenorhabditis elegans] ref|NP_872127.1| ROLler: helically twisted, animals roll when moving family member (rol-3) [Caenorhabditis elegans] |
0.0 |
blast |
CAE56943 |
Hypothetical protein CBG24788 [Caenorhabditis briggsae] |
0.0 |
blast |
T29551 |
hypothetical protein C16D9.2 - Caenorhabditis elegans |
0.0 |
blast |
CAE66100 |
Hypothetical protein CBG11320 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.8E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.8E-5 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
4.8E-17 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
8.7E-24 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.8E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.8E-5 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
4.8E-17 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
8.7E-24 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.8E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.8E-5 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
4.8E-17 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
8.7E-24 |
NP_872127.1 |
1 |
702-724 |
NP_505122.3 |
1 |
1848-1870 |
C16D9.2c |
1 |
702-724 |
C16D9.2a |
1 |
1848-1870 |
SNAP00000043373 |
1 |
1079-1101 | |
Sequence |
|
>C. ELEGANS:173773_S_AT
ggattacggagcttcatcatcaatgtattctccaggatcttccaatcgaatttcaagcca
agttgaccctccaattggtagattgagctctgctccaggaattggcatagtcaatgatgc
atttgagagcagtaatccatcgctgaatttgagtagaagttgggccgggctttcaagaga
agtgaatcagaatcctgctggtgctggtagtagtggaacacttccacagcatacgaactc
tgctggacatttgagactccctggggtccaagttggagcaggtggcggccgtgtctacag
aaatgcctctggcggtggtggaccttcaaatcgaggccgcatcagtcaagtct
BLASTn GenBank NR |
|
|
|
|
|
|
GGATTACGGAGCTTCATCATCAATG |
572 |
509 |
6802 |
Antisense |
GTATTCTCCAGGATCTTCCAATCGA |
150 |
453 |
6826 |
Antisense |
AAGCCAAGTTGACCCTCCAATTGGT |
567 |
147 |
6856 |
Antisense |
GAGCTCTGCTCCAGGAATTGGCATA |
19 |
389 |
6886 |
Antisense |
GTTGGGCCGGGCTTTCAAGAGAAGT |
501 |
433 |
6960 |
Antisense |
GAATCCTGCTGGTGCTGGTAGTAGT |
81 |
331 |
6991 |
Antisense |
GAACACTTCCACAGCATACGAACTC |
222 |
351 |
7017 |
Antisense |
TTGAGACTCCCTGGGGTCCAAGTTG |
250 |
683 |
7052 |
Antisense |
GCGGCCGTGTCTACAGAAATGCCTC |
496 |
293 |
7086 |
Antisense |
GGTGGTGGACCTTCAAATCGAGGCC |
45 |
501 |
7115 |
Antisense |
AATCGAGGCCGCATCAGTCAAGTCT |
373 |
169 |
7130 |
Antisense | |
|
Affymetrix Proprietary Database |