|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
173653_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.22759
|
|
Exemplar sequence
|
|
C69970 NCBI
|
|
C69970 /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=B0205.3 /5_PRIME_EXT_DB=WormBase Gene ID /GB=C69970 /WB_GENE_ID=B0205.3 /WP=CE26355 /CHR=1 /FEA=Genomic Cluster /GEN=rpn-10 /DEF=C.elegans cDNA clone yk370e11 : 5prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_060408(11) |
|
|
|
|
|
NM_060408 NCBI |
Caenorhabditis elegans proteasome Regulatory Particle, Non-ATPase-like family member (rpn-10) (rpn-10) mRNA, complete cds. |
11/11 |
None |
B0205.3.2 ENSEMBL |
cdna:known chromosome:CEL140:I:10738850:10740552:-1 gene:B0205.3 |
11/11 |
None |
B0205.3.1 ENSEMBL |
cdna:known chromosome:CEL140:I:10738850:10740545:-1 gene:B0205.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:10738798-10740444(-) |
93.62 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
rpn-10
|
|
B0205.3
|
|
172977 Entrez gene
|
|
O61742 EMBL-EBI
|
|
CE26355 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:16591_S_AT |
26S proteasome regulatory subunit S5A (RPN10) |
at |
ATH1-121501:252955_AT |
26S proteasome regulatory subunit S5A (RPN10) |
at |
DROSOPHILA_2:1635974_AT |
Proteasome 54kD subunit |
dm |
DROSGENOME1:154023_AT |
Proteasome 54kD subunit |
dm |
HG-U133_PLUS_2:211609_X_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133A:211609_X_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133A_2:211609_X_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133_PLUS_2:200882_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133A:200882_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133A_2:200882_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-FOCUS:200882_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133_PLUS_2:210460_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133A:210460_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133A_2:210460_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133_PLUS_2:210459_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133A:210459_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U133A_2:210459_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HUGENEFL:U24704_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
U133_X3P:G8918352_3P_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
U133_X3P:G8918352_3P_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
U133_X3P:G5292160_3P_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
U133_X3P:210459_3P_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
U133_X3P:200882_3P_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
HG-U95AV2:39749_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
hs |
MOE430A:1425859_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MOUSE430A_2:1425859_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MOUSE430_2:1425859_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MOUSE430_2:1418874_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MOE430A:1418874_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MOUSE430A_2:1418874_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MU11KSUBA:AF013099_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MG-U74AV2:94302_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MOE430A:1451725_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MOUSE430A_2:1451725_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MOUSE430_2:1451725_A_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
mm |
MU19KSUBC:TC37781_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, mRNA (cDNA clone MGC:6683 IMAGE:3581937) |
mm |
MU19KSUBC:TC37782_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, mRNA (cDNA clone MGC:6683 IMAGE:3581937) |
mm |
RG-U34A:AB017188_G_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
rn |
RG-U34A:RC_AA799887_S_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
rn |
RG-U34A:AB017188_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
rn |
RG-U34C:RC_AI236731_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
rn |
RAE230A:1386930_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
rn |
RAT230_2:1386930_AT |
proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
rn |
RAE230B:1392661_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
rn |
RAT230_2:1392661_AT |
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
rn |
YEAST_2:1771328_AT |
Non-ATPase base subunit of the 19S regulatory particle (RP) of the 26S proteasome; N-terminus plays a role in maintaining the structural integrity of the RP; binds selectively to polyubiquitin chains; homolog of the mammalian S5a protein |
Sc | |
|
|
|
|
|
blast |
AAK66019 |
Proteasome regulatory particle, non-atpase-like protein 10 [Caenorhabditis elegans] ref|NP_492809.1| proteasome Regulatory Particle, Non-ATPase-like family member (rpn-10) [Caenorhabditis elegans] |
1.0E-154 |
blast |
D87912 |
protein B0205.3 [imported] - Caenorhabditis elegans |
1.0E-154 |
blast |
CAE67355 |
Hypothetical protein CBG12818 [Caenorhabditis briggsae] |
1.0E-133 | |
|
|
|
|
|
Pfam |
IPR003903 EMBL-EBI |
Ubiquitin interacting motif |
3.8E-4 |
Pfam |
IPR003903 EMBL-EBI |
Ubiquitin interacting motif |
2.7E-6 | |
Sequence |
|
>C. ELEGANS:173653_AT
gagaagaaataaatgtccctgtgaagttgttttattgtattttatcctatttattattga
atcaccatccagccaccccaagtgaatgattttcagtctccaacttcttcttccccgctg
cgtaattctaatttattccatctctcatt
BLASTn GenBank NR |
|
|
|
|
|
|
GAGAAGAAATAAATGTCCCTGTGAA |
676 |
391 |
1043 |
Antisense |
AAATGTCCCTGTGAAGTTGTTTTAT |
185 |
119 |
1053 |
Antisense |
GTCCCTGTGAAGTTGTTTTATTGTA |
616 |
475 |
1057 |
Antisense |
TTGTATTTTATCCTATTTATTATTG |
575 |
705 |
1077 |
Antisense |
TATTATTGAATCACCATCCAGCCAC |
512 |
661 |
1094 |
Antisense |
CATCCAGCCACCCCAAGTGAATGAT |
502 |
211 |
1108 |
Antisense |
AGCCACCCCAAGTGAATGATTTTCA |
45 |
85 |
1113 |
Antisense |
ATGATTTTCAGTCTCCAACTTCTTC |
642 |
45 |
1128 |
Antisense |
TTCTTCCCCGCTGCGTAATTCTAAT |
463 |
689 |
1150 |
Antisense |
TCCCCGCTGCGTAATTCTAATTTAT |
629 |
595 |
1154 |
Antisense |
ATTCTAATTTATTCCATCTCTCATT |
405 |
11 |
1167 |
Antisense | |
|
Affymetrix Proprietary Database | |