|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
173307_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.27636
|
|
Exemplar sequence
|
|
CEC4414 NCBI
|
|
CEC4414_rc /REP_DB=TREMBL Accession /GB=C11441 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk179c11 : 3prime end, single read.
|
This cluster is supported by a Transcript Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_073400(11) |
|
|
|
|
|
NM_073400 NCBI |
Caenorhabditis elegans F53B7.5 (F53B7.5) mRNA, complete cds. |
11/11 |
A |
SNAP00000033903 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:10970558:10973748:-1 |
11/11 |
None |
GENEFINDER00000033915 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:10970558:10973692:-1 |
11/11 |
None |
F53B7.5 ENSEMBL |
cdna:known chromosome:CEL140:V:10972987:10982625:-1 gene:F53B7.5 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:10973098-10973512(-) |
73.7 |
73.7 |
| |
Public Domain and Genome References |
|
Thrombospondin type 1 domain
|
|
F53B7.5
|
|
179523 Entrez gene
|
|
Q19522 EMBL-EBI
|
|
CE05924 Wormbase
|
Functional Annotations |
|
|
|
|
|
6508 |
proteolysis |
inferred from electronic annotation |
QuickGO AmiGO |
8152 |
metabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4190 |
aspartic-type endopeptidase activity |
inferred from electronic annotation |
QuickGO AmiGO |
16491 |
oxidoreductase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA96654 |
Hypothetical protein F53B7.5 [Caenorhabditis elegans] emb|CAA96634.1| Hypothetical protein F53B7.5 [Caenorhabditis elegans] ref|NP_505801.1| F53B7.5 [Caenorhabditis elegans] |
0.0 |
blast |
CAE75138 |
Hypothetical protein CBG23067 [Caenorhabditis briggsae] |
0.0 |
blast |
CAE75138 |
Hypothetical protein CBG23067 [Caenorhabditis briggsae] |
5.0E-68 |
blast |
CAE75138 |
Hypothetical protein CBG23067 [Caenorhabditis briggsae] |
2.0E-33 |
blast |
CAA96654 |
Hypothetical protein F53B7.5 [Caenorhabditis elegans] emb|CAA96634.1| Hypothetical protein F53B7.5 [Caenorhabditis elegans] ref|NP_505801.1| F53B7.5 [Caenorhabditis elegans] |
1.0E-30 |
blast |
CAA96654 |
Hypothetical protein F53B7.5 [Caenorhabditis elegans] emb|CAA96634.1| Hypothetical protein F53B7.5 [Caenorhabditis elegans] ref|NP_505801.1| F53B7.5 [Caenorhabditis elegans] |
9.0E-30 |
blast |
CAE69706 |
Hypothetical protein CBG15974 [Caenorhabditis briggsae] |
5.0E-23 |
blast |
ZP_00421276 |
Haemagluttinin motif:Hep_Hag [Burkholderia vietnamiensis G4] gb|EAM32254.1| Haemagluttinin motif:Hep_Hag [Burkholderia vietnamiensis G4] |
2.0E-21 | |
|
|
|
|
|
Pfam |
IPR000884 EMBL-EBI |
Thrombospondin, type I |
1.7E-6 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
2.5E-28 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
4.1E-27 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
4.6E-38 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
1.6E-32 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
2.1E-39 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
5.6E-32 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
9.0E-38 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
7.6E-34 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
2.0E-38 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
1.4E-34 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
3.5E-35 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
7.6E-33 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
1.1E-36 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
7.9E-27 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
1.7E-30 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
5.1E-23 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
9.3E-36 |
Pfam |
IPR002601 EMBL-EBI |
Protein of unknown function C6 |
8.2E-31 |
Pfam |
IPR000884 EMBL-EBI |
Thrombospondin, type I |
1.7E-6 |
Pfam |
IPR002602 EMBL-EBI |
Protein of unknown function DB |
7.4E-18 |
Pfam |
IPR000884 EMBL-EBI |
Thrombospondin, type I |
1.7E-6 |
Pfam |
IPR002602 EMBL-EBI |
Protein of unknown function DB |
7.4E-18 |
GENEFINDER00000033915 |
2 |
137-159,164-186 | |
Sequence |
|
>C. ELEGANS:173307_S_AT
attgttcgacttcaacgtggaacgcatggcaagaatggtccacgtgtacagaaacatgtg
gatcatgtggaacacaacaacggttccgaagttgcaataaaccagttgacacgtgtacat
gctcaggatctgcattcgagaaggagtactgtaacctggccgtttgcaaatttccact
BLASTn GenBank NR |
|
|
|
|
|
|
ATTGTTCGACTTCAACGTGGAACGC |
314 |
5 |
97 |
Antisense |
CGTGGAACGCATGGCAAGAATGGTC |
285 |
243 |
112 |
Antisense |
AGAATGGTCCACGTGTACAGAAACA |
568 |
75 |
128 |
Antisense |
GGATCATGTGGAACACAACAACGGT |
628 |
511 |
156 |
Antisense |
ACAACAACGGTTCCGAAGTTGCAAT |
97 |
97 |
170 |
Antisense |
AATAAACCAGTTGACACGTGTACAT |
664 |
169 |
192 |
Antisense |
GACACGTGTACATGCTCAGGATCTG |
650 |
367 |
204 |
Antisense |
GTACATGCTCAGGATCTGCATTCGA |
630 |
459 |
211 |
Antisense |
GGATCTGCATTCGAGAAGGAGTACT |
500 |
511 |
222 |
Antisense |
GAAGGAGTACTGTAACCTGGCCGTT |
172 |
335 |
236 |
Antisense |
ACCTGGCCGTTTGCAAATTTCCACT |
517 |
81 |
250 |
Antisense | |
|
Affymetrix Proprietary Database |