|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
173291_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.27973
|
|
Exemplar sequence
|
|
CEK110A8R NCBI
|
|
CEK110A8R_rc /REP_DB=TREMBL Accession /GB=D72842 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk110a8 : 3prime end, single read.
|
This cluster is supported by a Transcript Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001027795(10) |
|
|
|
|
|
NM_001027795 NCBI |
Caenorhabditis elegans Y82E9BR.3 (Y82E9BR.3) mRNA, complete cds. |
10/11 |
None |
Y82E9BR.3.2 ENSEMBL |
cdna:known chromosome:CEL140:III:1419143:1419859:1 gene:Y82E9BR.3 |
11/11 |
None |
Y82E9BR.3.1 ENSEMBL |
cdna:known chromosome:CEL140:III:1419180:1419859:1 gene:Y82E9BR.3 |
11/11 |
None |
Y82E9BR.3.4 ENSEMBL |
cdna:known chromosome:CEL140:III:1419184:1419904:1 gene:Y82E9BR.3 |
10/11 |
None |
Y82E9BR.3.3 ENSEMBL |
cdna:known chromosome:CEL140:III:1419192:1419863:1 gene:Y82E9BR.3 |
11/11 |
None | |
SNAP00000008912 |
5/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000008935 |
6/11 |
Cross Hyb Matching Probes |
None | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:1419194-1419828(+) |
97.74 |
97.74 |
| |
Public Domain and Genome References |
|
|
|
Y82E9BR.3
|
|
175299 Entrez gene
|
|
Q9BKS0 EMBL-EBI
|
|
CE27044 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1589664_S_AT |
similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c, isoform 1 |
cfa |
CANINE_2:CFA.685.1.S1_S_AT |
similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c, isoform 1 |
cfa |
CHICKEN:GGA.1254.1.S1_A_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
gga |
HG-U133A:208972_S_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
HG-U133_PLUS_2:208972_S_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
HG-U133A_2:208972_S_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
HG-FOCUS:208972_S_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
HUGENEFL:D13118_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
U133_X3P:G5262506_3P_A_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
HG-U95AV2:38076_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
HG-U95D:88330_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
HU35KSUBC:RC_AA083351_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
hs |
MU11KSUBA:L19737_F_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MU11KSUBB:MSA.9697.0_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MU11KSUBB:MSA.24227.0_F_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MU11KSUBB:MSA.21817.0_S_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MG-U74AV2:161324_R_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MOE430A:1416020_A_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MOUSE430A_2:1416020_A_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MOUSE430_2:1416020_A_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MOE430B:1444874_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MOUSE430_2:1444874_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MG-U74AV2:96032_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
mm |
MG-U74CV2:165501_R_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1, mRNA (cDNA clone MGC:6436 IMAGE:3601516) |
mm |
MU11KSUBB:MSA.24253.0_F_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1, mRNA (cDNA clone MGC:6436 IMAGE:3601516) |
mm |
RG-U34A:D13123_S_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
rn |
RAE230A:1367599_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
rn |
RAT230_2:1367599_AT |
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 |
rn | |
|
|
|
|
|
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAK26152 |
Hypothetical protein Y82E9BR.3 [Caenorhabditis elegans] ref|NP_001022966.1| Y82E9BR.3 [Caenorhabditis elegans] emb|CAE66435.1| Hypothetical protein CBG11706 [Caenorhabditis briggsae] |
3.0E-37 |
blast |
BAA21841.1 |
ATP synthase subunit [Caenorhabditis elegans] dbj|BAA13165.1| ATP synthase subunit [Caenorhabditis elegans] |
1.0E-32 | |
|
|
|
|
|
Pfam |
IPR002379 EMBL-EBI |
H+-transporting two-sector ATPase, C subunit |
3.9E-28 |
NP_001022966.1 |
2 |
55-77,92-114 |
Y82E9BR.3.2 |
2 |
55-77,92-114 |
Y82E9BR.3.1 |
2 |
55-77,92-114 |
Y82E9BR.3.4 |
2 |
55-77,92-114 |
Y82E9BR.3.3 |
2 |
55-77,92-114 | |
Sequence |
|
>C. ELEGANS:173291_AT
tcgctctccgcatggagaacgccgtcgctgcccgcatgatcagcaccaccgtcgcccgca
aggacatcgactctgctgccaagtacatcggagctggagccgccaccgttggagtcgctg
gatctggagccggtatcggaaacgtcttcggagccctcgtcatcggatacgcccgtaacc
catccctcaagcaacagctcttctcgtacgccatccttggattcgctctctccgaggcca
tgggactgttctgcttgactatgggtttcatgatcttgttcgctctctaaatgttctgtt
ttatagccgannnnngttttnnnnnnnnnnnnnnnnnnnngaagtcctctccaacgtcta
aattcttcataacaacaaagaacgtaggctgcggtgtcggatcttcaaactcagtaatct
attagttcgaataaaatccttcgactagccaccttgtataactc
BLASTn GenBank NR |
|
|
|
|
|
|
TCGCTCTCCGCATGGAGAACGCCGT |
602 |
591 |
86 |
Antisense |
GACTCTGCTGCCAAGTACATCGGAG |
56 |
375 |
154 |
Antisense |
CGTTGGAGTCGCTGGATCTGGAGCC |
583 |
247 |
192 |
Antisense |
GAGCCGGTATCGGAAACGTCTTCGG |
593 |
385 |
212 |
Antisense |
GACTGTTCTGCTTGACTATGGGTTT |
548 |
375 |
329 |
Antisense |
ATGGGTTTCATGATCTTGTTCGCTC |
180 |
51 |
346 |
Antisense |
TGTTCGCTCTCTAAATGTTCTGTTT |
250 |
563 |
362 |
Antisense |
CCTCTCCAACGTCTAAATTCTTCAT |
431 |
267 |
431 |
Antisense |
AGAACGTAGGCTGCGGTGTCGGATC |
685 |
71 |
464 |
Antisense |
GGTGTCGGATCTTCAAACTCAGTAA |
542 |
497 |
478 |
Antisense |
TTCGACTAGCCACCTTGTATAACTC |
193 |
695 |
525 |
Antisense | |
|
Affymetrix Proprietary Database | |