[Home] | [Total List]

[173284_s_at] RNA binding domain /// Snf5 (yeast)

Description CEC974_rc /REP_DB=TREMBL Accession /GB=C07974 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk172f3 : 3prime end, single read.
Cluster 6grp_highest_10_10 > 63      6grp_high1_10_10 > 36      4grp_highest_8_8 > 04      4grp_high_8_8 > 37      6grp_highest_nonorm > 74      6grp_total > 35      4grp_total > 34      6grp_highest_sub > Cu      6grp_cgc > 35      6grp_high1_sub > Cu      6grp_cgc_sub > Cu      6grp_total_sub > Cup      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 439
1 2 3 4 range
A 743
(-3)
P 		1085.6
(3)
P 		752.8
(-2.8)
P 		958.4
(0.8)
P 		343
B 783.3
(-3)
P 		926.1
(3)
P 		895.9
(1.7)
P 		800.3
(-2.3)
P 		143
C 646.4
(-3)
P 		892.2
(3)
P 		814.3
(1.1)
P 		808
(0.9)
P 		246
avr 724.2
(-3) 		968
(3) 		821
(-0.6) 		855.6
(0.2) 		244

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 425
1 2 3 4 5 6 range
A 630.6
(3)
P 		541.8
(0.7)
P 		607.6
(2.4)
P 		609.9
(2.5)
P 		402.5
(-3)
P 		585.1
(1.8)
P 		228
B 658
(0.8)
P 		778
(3)
P 		582.7
(-0.6)
P 		449.1
(-3)
P 		496.6
(-2.1)
P 		712.6
(1.8)
P 		329
C 827.2
(3)
P 		803.5
(2.3)
P 		738.8
(0.2)
P 		654.8
(-2.4)
P 		636.2
(-3)
P 		643.2
(-2.8)
P 		191
avr 705.3
(2.9) 		707.8
(3) 		643
(1) 		571.3
(-1.2) 		511.8
(-3) 		647
(1.1) 		196
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 148
1 2 3 4 range
A 270.5
(3)
P 		235.7
(1.4)
P 		196.8
(-0.4)
P 		140.3
(-3)
P 		130
B 249.8
(3)
P 		228.7
(1.4)
P 		207.6
(-0.2)
P 		170.6
(-3)
P 		79
C 214
(0.2)
P 		256.5
(1.9)
P 		283.8
(3)
P 		136.2
(-3)
P 		148
avr 244.8
(3) 		240.3
(2.7) 		229.4
(2) 		149
(-3) 		96

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 190
1 2 3 4 5 6 range
A 116.2
(-3)
P 		192.7
(3)
P 		132.3
(-1.7)
P 		154.7
(0)
P 		121.5
(-2.6)
P 		142.5
(-0.9)
P 		77
B 229
(1.5)
P 		259
(2.7)
P 		141.5
(-2.1)
P 		118.9
(-3)
P 		201.8
(0.4)
P 		265.7
(3)
P 		147
C 306.6
(3)
P 		245.2
(0.9)
P 		188
(-1.1)
P 		131.7
(-3)
P 		205.9
(-0.5)
P 		215.3
(-0.1)
P 		175
avr 217.3
(2.1) 		232.3
(3) 		153.9
(-1.8) 		135.1
(-3) 		176.4
(-0.5) 		207.8
(1.5) 		97
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 173284_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.27919
Sequence Type Exemplar sequence
Representative Public ID CEC974 NCBI
Target Description CEC974_rc /REP_DB=TREMBL Accession /GB=C07974 /FEA=Transcript Cluster /DEF=C.elegans cDNA clone yk172f3 : 3prime end, single read.
Cluster Evidence This cluster is supported by a Transcript Cluster.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_065489(11), NM_065490(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_065489 NCBI Caenorhabditis elegans R07E5.3 (R07E5.3) mRNA, complete cds. 11/11 None
NM_065490 NCBI Caenorhabditis elegans RNP (RRM RNA binding domain) containing family member (rnp-4) (rnp-4) mRNA, complete cds. 11/11 A 
GENEFINDER00000012865 ENSEMBL cdna:GeneFinder chromosome:CEL140:III:4404758:4407072:1 11/11 None
SNAP00000012849 ENSEMBL cdna:SNAP chromosome:CEL140:III:4406287:4407072:1 11/11 None
R07E5.3 ENSEMBL cdna:known chromosome:CEL140:III:4404755:4407231:1 gene:R07E5.3 11/11 None
R07E5.14.2 ENSEMBL cdna:known chromosome:CEL140:III:4406249:4407279:1 gene:R07E5.14 11/11 A 
R07E5.14.3 ENSEMBL cdna:known chromosome:CEL140:III:4406249:4407295:1 gene:R07E5.14 11/11 None
R07E5.14.1 ENSEMBL cdna:known chromosome:CEL140:III:4406255:4407281:1 gene:R07E5.14 11/11 A 
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIII:4406619-4407230(+) 100.0 100.0
Public Domain and Genome References
Gene Title RNA binding domain
Snf5 (yeast)
Gene Symbol rnp-4
Ensembl R07E5.3
R07E5.14
Entrez Gene 175571 Entrez gene
175572 Entrez gene
SwissProt Q21832 EMBL-EBI
Q21831 EMBL-EBI
WormBase CE01044 Wormbase
CE01045 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:260487_AT RNA-binding protein, putative at
CANINE_2:CFAAFFX.17487.1.S1_S_AT similar to RNA-binding protein 8A (RNA binding motif protein 8A) (Ribonucleoprotein RBM8A) cfa
CANINE:1590853_AT similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 cfa
CANINE_2:CFA.9379.1.S1_AT similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 cfa
CANINE_2:CFAAFFX.21777.1.S1_AT similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 cfa
DROSOPHILA_2:1623902_AT tsunagi dm
DROSGENOME1:146865_AT tsunagi dm
DROSOPHILA_2:1625112_AT Snf5-related 1 dm
DROSGENOME1:152195_AT Snf5-related 1 dm
CHICKEN:GGA.4349.1.S1_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 gga
CHICKEN:GGA.4349.2.S1_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 gga
CHICKEN:GGA.8558.1.S1_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 gga
HG-U133_PLUS_2:213852_AT RNA binding motif protein 8A hs
HG-U133A_2:213852_AT RNA binding motif protein 8A hs
HG-U133A:213852_AT RNA binding motif protein 8A hs
HG-U133A:217857_S_AT RNA binding motif protein 8A hs
HG-U133_PLUS_2:217857_S_AT RNA binding motif protein 8A hs
HG-U133A_2:217857_S_AT RNA binding motif protein 8A hs
HG-U133B:222443_S_AT RNA binding motif protein 8A hs
HG-U133_PLUS_2:222443_S_AT RNA binding motif protein 8A hs
HG-U95AV2:40819_AT RNA binding motif protein 8A hs
HU35KSUBA:RC_AA243052_AT RNA binding motif protein 8A hs
HU35KSUBA:RC_AA450078_AT RNA binding motif protein 8A hs
HU35KSUBA:HUM_ALU_AT RNA binding motif protein 8A hs
HU35KSUBB:HUM_ALU_AT RNA binding motif protein 8A hs
HU35KSUBC:HUM_ALU_AT RNA binding motif protein 8A hs
HU35KSUBD:HUM_ALU_AT RNA binding motif protein 8A hs
HUGENEFL:HUM_ALU_AT RNA binding motif protein 8A hs
HC-G110:HUM_ALU_AT RNA binding motif protein 8A hs
HU35KSUBD:RC_T89703_AT RNA binding motif protein 8A hs
U133_X3P:G4826971_3P_S_AT RNA binding motif protein 8A hs
U133_X3P:G10197629_3P_S_AT RNA binding motif protein 8A hs
U133_X3P:HS.65648.2.A1_3P_AT RNA binding motif protein 8A hs
U133_X3P:HS.65648.1.A1_3P_S_AT RNA binding motif protein 8A hs
U133_X3P:HS.65648.1.A1_3P_AT RNA binding motif protein 8A hs
U133_X3P:HS.65648.0.S3_3P_AT RNA binding motif protein 8A hs
U133_X3P:214113_3P_S_AT RNA binding motif protein 8A hs
HG-U133A_2:214113_S_AT RNA binding motif protein 8A hs
HG-FOCUS:214113_S_AT RNA binding motif protein 8A hs
HG-U133_PLUS_2:214113_S_AT RNA binding motif protein 8A hs
HG-U133A:214113_S_AT RNA binding motif protein 8A hs
HG-U133A_2:217856_AT RNA binding motif protein 8A hs
HG-U133_PLUS_2:217856_AT RNA binding motif protein 8A hs
HG-U133A:217856_AT RNA binding motif protein 8A hs
HG-U95AV2:40820_AT RNA binding motif protein 8A hs
HG-U95C:64886_AT RNA binding motif protein 8A hs
U133_X3P:HS2.351932.1.S1_3P_AT RNA binding motif protein 8A hs
HG-U133_PLUS_2:1554602_AT RNA binding motif protein 8A hs
HG-U133_PLUS_2:228898_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-U133B:228898_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HU35KSUBC:RC_T64349_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
U133_X3P:HS.159971.2.A1_3P_A_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
U133_X3P:HS.14587.2.S1_3P_A_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-U133A_2:212167_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-FOCUS:212167_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-U133_PLUS_2:212167_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-U133A:212167_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-U95AV2:40416_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-U133_PLUS_2:231324_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-U133B:231324_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
HG-U95E:86416_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
U133_X3P:HS.198671.0.A1_3P_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 hs
MOE430A:1418120_AT RNA binding motif protein 8a mm
MOUSE430A_2:1418120_AT RNA binding motif protein 8a mm
MOUSE430_2:1418120_AT RNA binding motif protein 8a mm
MU11KSUBB:MSA.22528.0_S_AT RNA binding motif protein 8a mm
MG-U74AV2:97254_AT RNA binding motif protein 8a mm
MG-U74CV2:129774_F_AT RNA binding motif protein 8a mm
MG-U74CV2:168960_AT RNA binding motif protein 8a mm
MOE430A:1418119_AT RNA binding motif protein 8a mm
MOUSE430A_2:1418119_AT RNA binding motif protein 8a mm
MOUSE430_2:1418119_AT RNA binding motif protein 8a mm
MU19KSUBB:TC31434_AT RNA binding motif protein 8a, mRNA (cDNA clone MGC:29053 IMAGE:3671644) mm
MG-U74AV2:96050_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 mm
MOE430A:1416045_A_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 mm
MOUSE430A_2:1416045_A_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 mm
MOUSE430_2:1416045_A_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 mm
MOE430A:1435856_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA (cDNA clone MGC:36040 IMAGE:3154501) mm
MOUSE430A_2:1435856_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA (cDNA clone MGC:36040 IMAGE:3154501) mm
MOUSE430_2:1435856_X_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA (cDNA clone MGC:36040 IMAGE:3154501) mm
MOUSE430_2:1456938_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA (cDNA clone MGC:36040 IMAGE:3154501) mm
MOE430B:1456938_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA (cDNA clone MGC:36040 IMAGE:3154501) mm
MU19KSUBA:TC24709_S_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA (cDNA clone MGC:36040 IMAGE:3154501) mm
MU19KSUBB:TC33273_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA (cDNA clone MGC:36040 IMAGE:3154501) mm
RG-U34B:RC_AA996689_AT RNA binding motif protein 8 (predicted) rn
RG-U34B:RC_AI044836_AT RNA binding motif protein 8 (predicted) rn
RG-U34C:RC_AI145282_AT RNA binding motif protein 8 (predicted) rn
RAE230A:1372829_AT RNA binding motif protein 8 (predicted) rn
RAT230_2:1372829_AT RNA binding motif protein 8 (predicted) rn
RAE230B:1384751_AT RNA binding motif protein 8 (predicted) rn
RAT230_2:1384751_AT RNA binding motif protein 8 (predicted) rn
RN-U34:RC_H33459_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (predicted) rn
RG-U34A:RC_H33459_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (predicted) rn
RN-U34:RC_H33459_G_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (predicted) rn
RG-U34A:RC_H33459_G_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (predicted) rn
RAE230A:1371914_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (predicted) rn
RAT230_2:1371914_AT SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (predicted) rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6396 RNA processing inferred from electronic annotation QuickGO AmiGO
6338 chromatin remodeling inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
5737 cytoplasm inferred from electronic annotation QuickGO AmiGO
228 nuclear chromosome inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3723 RNA binding inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast CAA83625 Hypothetical protein R07E5.3 [Caenorhabditis elegans] ref|NP_497890.1| R07E5.3 [Caenorhabditis elegans] 0.0
blast CAE71212 Hypothetical protein CBG18075 [Caenorhabditis briggsae] 0.0
blast XP_781133 PREDICTED: similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 isoform b [Strongylocentrotus purpuratus] 3.0E-96
blast XP_781133 PREDICTED: similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 isoform b [Strongylocentrotus purpuratus] 5.0E-96
blast CAA83626 Hypothetical protein R07E5.14 [Caenorhabditis elegans] ref|NP_497891.1| RNP (RRM RNA binding domain) containing family member (rnp-4) [Caenorhabditis elegans] 4.0E-77
Protein Domains
Database ID Description E-Value
Pfam IPR006939 EMBL-EBI SNF5/SMARCB1/INI1 1.0E-126
Pfam IPR000504 EMBL-EBI RNA-binding region RNP-1 (RNA recognition motif) 1.2E-21
Pfam IPR000504 EMBL-EBI RNA-binding region RNP-1 (RNA recognition motif) 4.5E-17
Sequence
Target Sequence 
>C. ELEGANS:173284_S_AT
gaagggatacgcactggtggagtacgaaacgcagaaggaagccaacgaagctattgatca
gagcaacgatacagatcttctcggccagaatgtcaaagtcgattggtgcttcgtcaaggg
aaagaagacttctggaaagcgctga

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
GAAGGGATACGCACTGGTGGAGTAC 276 333 14 Antisense
ACGCACTGGTGGAGTACGAAACGCA 388 39 22 Antisense
GTACGAAACGCAGAAGGAAGCCAAC 668 457 35 Antisense
GGAAGCCAACGAAGCTATTGATCAG 119 531 50 Antisense
GAAGCTATTGATCAGAGCAACGATA 699 341 60 Antisense
GCAACGATACAGATCTTCTCGGCCA 317 319 76 Antisense
ACAGATCTTCTCGGCCAGAATGTCA 132 109 84 Antisense
CTTCTCGGCCAGAATGTCAAAGTCG 103 219 90 Antisense
GTCAAAGTCGATTGGTGCTTCGTCA 306 465 105 Antisense
GTCGATTGGTGCTTCGTCAAGGGAA 324 473 111 Antisense
AAAGAAGACTTCTGGAAAGCGCTGA 403 121 134 Antisense
Sequence Source Affymetrix Proprietary Database